View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_146 (Length: 229)

Name: NF0784_low_146
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_146
NF0784_low_146
[»] chr1 (3 HSPs)
chr1 (13-229)||(15814460-15814675)
chr1 (94-139)||(16072354-16072399)
chr1 (94-139)||(16086007-16086052)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 15814460 - 15814675
Alignment:
Q  13 cagagaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataattattttttgaaggaaataaatgataaaatttgtctccatagaga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||    
T  15814460 cagagaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataatt-ttttttgaaggtaataaatgataaaatttgtctccatagaga 15814558  T
Q  113 ttgtgatcaatcaacaaactcatcaataagaacggaagtatcattaacatcaataagaacgtaagtatcatggctaactctctcgttgcaaagattcgcc 212  Q
    |||||||||||||| |||| |||||||||||||||||||||| |||||| ||||||||||| ||||||||||| ||||||| | |||||||||||||| |    
T  15814559 ttgtgatcaatcaataaacccatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgac 15814658  T
Q  213 gtattcttctgatggat 229  Q
    || |||||| |||||||    
T  15814659 gtcttcttcagatggat 15814675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 16072354 - 16072399
Alignment:
Q  94 aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat 139  Q
    ||||||||||||||||||||||||||||||| | ||| ||||||||    
T  16072354 aaatttgtctccatagagattgtgatcaatcgataaaatcatcaat 16072399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 16086007 - 16086052
Alignment:
Q  94 aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat 139  Q
    ||||||||||| ||||||||||||||||||  | ||||||||||||    
T  16086007 aaatttgtctctatagagattgtgatcaattgataaactcatcaat 16086052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University