View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0783_low_12 (Length: 283)

Name: NF0783_low_12
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0783_low_12
NF0783_low_12
[»] chr4 (1 HSPs)
chr4 (88-181)||(1000257-1000350)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 88 - 181
Target Start/End: Original strand, 1000257 - 1000350
Alignment:
Q  88 aaatattactcctataatcaggtctaacggatatggagctagactactacaacaccataatgtaatgatctaaaattcagaacttagagaagaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1000257 aaatattactcctataatcaggtctaacggatatggagctagactactacaacaccataatgtaatgatctaaaattcagaacttagagaagaa 1000350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University