View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0781_low_38 (Length: 202)

Name: NF0781_low_38
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0781_low_38
NF0781_low_38
[»] chr2 (1 HSPs)
chr2 (1-119)||(32853111-32853229)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 32853229 - 32853111
Alignment:
Q  1 caatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatcacttgtgtaattgctcttagtctaacctgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32853229 caatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatcacttgtgtaattgctcttagtctaacctgat 32853130  T
Q  101 tatcctgtgtttaaaggct 119  Q
    |||||||||||||||||||    
T  32853129 tatcctgtgtttaaaggct 32853111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University