View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_81 (Length: 234)

Name: NF0780_low_81
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_81
NF0780_low_81
[»] chr3 (1 HSPs)
chr3 (1-72)||(45654554-45654625)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45654554 - 45654625
Alignment:
Q  1 taaacaatagaaacttttatgatttcatctcatttctttctattaacacaaacatttaatgtgattcttttt 72  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45654554 taaacaatagaaacttttatgatttcatctcatttctttctattaacacaaacatttaatgtgattcttttt 45654625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University