View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_73 (Length: 255)

Name: NF0780_low_73
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_73
NF0780_low_73
[»] chr8 (2 HSPs)
chr8 (49-243)||(473788-473974)
chr8 (206-242)||(479411-479447)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 49 - 243
Target Start/End: Original strand, 473788 - 473974
Alignment:
Q  49 taaataaacgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataataaagcctaggattgcatatataaataaggt 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||    
T  473788 taaataaacgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataaaaaagcctaggattgtatatataaataaggt 473887  T
Q  149 ttacc--atctctttatattcacccnnnnnnnnnnnnnnnnnnnctttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtat 243  Q
    |||||  ||||||||||||||||||                   |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  473888 ttaccatatctctttatattcaccc----------aaaaaaaaactttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtat 473974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 242
Target Start/End: Original strand, 479411 - 479447
Alignment:
Q  206 tttggaaagcaaagatgggatgtttagacatggagta 242  Q
    |||||||||||||||||||||||||||||||||||||    
T  479411 tttggaaagcaaagatgggatgtttagacatggagta 479447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University