View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_24 (Length: 346)

Name: NF0780_low_24
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_24
NF0780_low_24
[»] chr6 (1 HSPs)
chr6 (184-252)||(275284-275356)


Alignment Details
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 184 - 252
Target Start/End: Original strand, 275284 - 275356
Alignment:
Q  184 taaaaactcttaaagctgacagtgtatatgaattaaagcc----ataaattataacaagagaattatatacct 252  Q
    ||||||||||||||||||||||||||||||||||||| ||    |||||||||||||||||||||||||||||    
T  275284 taaaaactcttaaagctgacagtgtatatgaattaaacccataaataaattataacaagagaattatatacct 275356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University