View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_108 (Length: 204)

Name: NF0780_low_108
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_108
NF0780_low_108
[»] chr7 (1 HSPs)
chr7 (1-83)||(41703523-41703605)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 41703523 - 41703605
Alignment:
Q  1 cttcactcttgatcttcaatcctaattatgcataggaggcgttccacaatatccctcatactaggcctttcaactttcttctc 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41703523 cttcactcttgatcttcaatcctaattatgcataggaggcgttccacaatatccctcatactaggcctttcaactttcttctc 41703605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University