View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_102 (Length: 209)

Name: NF0780_low_102
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_102
NF0780_low_102
[»] chr8 (1 HSPs)
chr8 (16-134)||(20523514-20523632)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 16 - 134
Target Start/End: Complemental strand, 20523632 - 20523514
Alignment:
Q  16 taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20523632 taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg 20523533  T
Q  116 tgcctgttacctttgtttc 134  Q
    |||||||||||||||||||    
T  20523532 tgcctgttacctttgtttc 20523514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University