View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0777_low_42 (Length: 245)

Name: NF0777_low_42
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0777_low_42
NF0777_low_42
[»] scaffold0276 (1 HSPs)
scaffold0276 (1-143)||(8667-8816)


Alignment Details
Target: scaffold0276 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0276
Description:

Target: scaffold0276; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 8667 - 8816
Alignment:
Q  1 acgacgatgacaggaaagaataggacaaaactttaataaaaggtattttcaattaatagtttcctgcagaaatgcttttatcaataatttgctttatacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  8667 acgacgatgacaggaaagaataggacaaaactttaataaaaggtagtttcaattaataatttcctgcagaaatgcttttatcaataatttgctttatacg 8766  T
Q  101 gtcgtactccttgc-------ttgtgattatatttagcgggtggggattg 143  Q
    ||||||||||||||       |||||||||||||||||||||||||||||    
T  8767 gtcgtactccttgcttgtgaattgtgattatatttagcgggtggggattg 8816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University