View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0775_low_69 (Length: 236)

Name: NF0775_low_69
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0775_low_69
NF0775_low_69
[»] chr7 (1 HSPs)
chr7 (14-129)||(26529953-26530068)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 14 - 129
Target Start/End: Original strand, 26529953 - 26530068
Alignment:
Q  14 atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacacgatatgaagatgcaaatc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  26529953 atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacaggatatgaagatgcaaatc 26530052  T
Q  114 atctcaaatacctacc 129  Q
    ||||||||||||||||    
T  26530053 atctcaaatacctacc 26530068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University