View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0774_low_32 (Length: 280)

Name: NF0774_low_32
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0774_low_32
NF0774_low_32
[»] chr4 (2 HSPs)
chr4 (60-175)||(4823960-4824075)
chr4 (176-229)||(4824363-4824416)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 60 - 175
Target Start/End: Original strand, 4823960 - 4824075
Alignment:
Q  60 catactactccaaactgtgagtaaatagtcatctggtctttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaa 159  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4823960 catactactccaaactgtgagtaaatagtcatctggtccttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaa 4824059  T
Q  160 gtgtgttttctggacc 175  Q
    ||||||||||||||||    
T  4824060 gtgtgttttctggacc 4824075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 4824363 - 4824416
Alignment:
Q  176 ttcctgtcagttacttatagaagtgagtaaacactccaaaattggtacattgaa 229  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  4824363 ttcctgtcagtttcttatagaagtgagtaaacactccaaaattggtacattgaa 4824416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University