View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0759_low_98 (Length: 251)

Name: NF0759_low_98
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0759_low_98
NF0759_low_98
[»] chr5 (1 HSPs)
chr5 (86-230)||(40174345-40174489)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 86 - 230
Target Start/End: Complemental strand, 40174489 - 40174345
Alignment:
Q  86 gaagtggtgttccggtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt 185  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40174489 gaagtggtgttcctgtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt 40174390  T
Q  186 atgtttgtttctgttattttgctcttactttgtttgatgatgatg 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  40174389 atgtttgtttctgttattttgctcttactttgtttgatgatgatg 40174345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University