View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0752_low_28 (Length: 206)

Name: NF0752_low_28
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0752_low_28
NF0752_low_28
[»] chr3 (1 HSPs)
chr3 (1-50)||(21194282-21194331)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 21194331 - 21194282
Alignment:
Q  1 ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttgga 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21194331 ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttgga 21194282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University