View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_45 (Length: 201)

Name: NF0745_low_45
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_45
NF0745_low_45
[»] chr4 (1 HSPs)
chr4 (1-117)||(53233610-53233726)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 53233726 - 53233610
Alignment:
Q  1 tgaaccaattcaatccgacgaaatagatcatccatcttcaacttcgtcagcaacaactttaagcttcgccttacctattaaacaagacccttctaccgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53233726 tgaaccaattcaatccgacgaaatagatcatccatcttcaacttcgtcagcaacaactttaagcttcgccttacctattaaacaagacccttctaccgat 53233627  T
Q  101 tattggtccaatattct 117  Q
    |||||||||||||||||    
T  53233626 tattggtccaatattct 53233610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University