View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_30 (Length: 272)

Name: NF0745_low_30
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_30
NF0745_low_30
[»] chr8 (5 HSPs)
chr8 (14-272)||(28289263-28289521)
chr8 (14-272)||(28279398-28279656)
chr8 (14-272)||(28264215-28264473)
chr8 (19-272)||(28304232-28304485)
chr8 (22-272)||(28294030-28294280)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 272
Target Start/End: Original strand, 28289263 - 28289521
Alignment:
Q  14 atataagtacaggtaaggctagcaaagagtcggatgtgtacagttttggggttgttaccttggagatcacaaccggaaggaaagccgttgaagttatgag 113  Q
    ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||| ||| ||||||| ||||||||||||||    
T  28289263 atataagtacaggtaaggctagcaaagagtcagatgtgtatagttttggggttgttgccttggagatcacaactggacggaaagctgttgaagttatgag 28289362  T
Q  114 ggataaagatggagataagggattgattgagtgggtttgggatcattatggaagaggagagttacttgtggcaatggatgagaacttgaaaaaggatttt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| | ||||||||||| |||  |||||||||     
T  28289363 ggataaagatggagataagggattgattgagtgggtttgggatcatcatggaagaggagagctacttgtgaccatggatgagaatttgcgaaaggatttc 28289462  T
Q  214 gttgagaaacaagttgagtgtttgatgattgttggattgtggtgtgctcatcctgatgt 272  Q
    | |||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||    
T  28289463 gatgagaaacaagtagagtgtttgttgattgttggattatggtgtgctcatcctgatgt 28289521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 14 - 272
Target Start/End: Original strand, 28279398 - 28279656
Alignment:
Q  14 atataagtacaggtaaggctagcaaagagtcggatgtgtacagttttggggttgttaccttggagatcacaaccggaaggaaagccgttgaagttatgag 113  Q
    |||||||||||||||||||||||||||| || ||||| || || |||||||||||   ||||||||||||||| ||||||||||||||||||||||||      
T  28279398 atataagtacaggtaaggctagcaaagaatctgatgtctatagctttggggttgtcgtcttggagatcacaactggaaggaaagccgttgaagttatgga 28279497  T
Q  114 ggataaagatggagataagggattgattgagtgggtttgggatcattatggaagaggagagttacttgtggcaatggatgagaacttgaaaaaggatttt 213  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||  |||| ||| | ||||||||||| |||  |||||||||     
T  28279498 ggacaaagatggagataagggattgattgagtgggtttgggatcattatggaagagaagaaatactcgtgaccatggatgagaatttgcgaaaggatttc 28279597  T
Q  214 gttgagaaacaagttgagtgtttgatgattgttggattgtggtgtgctcatcctgatgt 272  Q
    | |||||||||||| ||||||||| ||||||||||||| ||||||| ||||||||||||    
T  28279598 gatgagaaacaagtagagtgtttgttgattgttggattatggtgtgttcatcctgatgt 28279656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 28264473 - 28264215
Alignment:
Q  14 atataagtacaggtaaggctagcaaagagtcggatgtgtacagttttggggttgttaccttggagatcacaaccggaaggaaagccgttgaagttatgag 113  Q
    ||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||| ||| |||| |||| |||||| ||| |||||||||     
T  28264473 atataagtacaggtaagactagcaaagagtcagatgtgtatagttttggggttgttgccttggaaatcgcaactggaaagaaagctgttcaagttatgaa 28264374  T
Q  114 ggataaagatggagataagggattgattgagtgggtttgggatcattatggaagaggagagttacttgtggcaatggatgagaacttgaaaaaggatttt 213  Q
    |||  ||| || |||||||||||| ||||| |||||||||||||||||||||||||||||  |||||||| | ||||||||||| ||| |||||||||||    
T  28264373 ggaacaaggtgaagataagggattaattgactgggtttgggatcattatggaagaggagaactacttgtgactatggatgagaatttgcaaaaggatttt 28264274  T
Q  214 gttgagaaacaagttgagtgtttgatgattgttggattgtggtgtgctcatcctgatgt 272  Q
    | |||||||||||| |||| |||| ||||||||||||| |||||||||||||| |||||    
T  28264273 gatgagaaacaagtagagtttttgttgattgttggattatggtgtgctcatccggatgt 28264215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 28304485 - 28304232
Alignment:
Q  19 agtacaggtaaggctagcaaagagtcggatgtgtacagttttggggttgttaccttggagatcacaaccggaaggaaagccgttgaagttatgagggata 118  Q
    |||||||| | ||| || |||||||| ||||| || ||||||||| | |||  ||| ||||| ||  ||||||  |||||   ||||||||||| ||| |    
T  28304485 agtacaggaagggcgagtaaagagtcagatgtttatagttttgggatagttgtcttagagataacctccggaaaaaaagctactgaagttatgaaggaga 28304386  T
Q  119 aagatggagataagggattgattgagtgggtttgggatcattatggaagaggagagttacttgtggcaatggatgagaacttgaaaaaggattttgttga 218  Q
    |||||| ||| |||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||  || ||||||| |||    
T  28304385 aagatgaagagaagggaatgattgagtgggtttgggatcattatggaaaaggagagctacttgtggcaatggatgagaatttgaggaaagattttgatga 28304286  T
Q  219 gaaacaagttgagtgtttgatgattgttggattgtggtgtgctcatcctgatgt 272  Q
    ||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||    
T  28304285 gaaacaagtagagtgcttgatgattgttggattatggtgtgctcatcctgatgt 28304232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 22 - 272
Target Start/End: Complemental strand, 28294280 - 28294030
Alignment:
Q  22 acaggtaaggctagcaaagagtcggatgtgtacagttttggggttgttaccttggagatcacaaccggaaggaaagccgttgaagttatgagggataaag 121  Q
    ||||||| ||| || |||||||| |||||||| ||||||||| | ||| | |||||||| || || || | ||||||   | |||| |||| | | |||     
T  28294280 acaggtagggcaagtaaagagtcagatgtgtatagttttgggatagttgctttggagataactactggtaagaaagctactaaagtgatgaagcaaaaaa 28294181  T
Q  122 atggagataagggattgattgagtgggtttgggatcattatggaagaggagagttacttgtggcaatggatgagaacttgaaaaaggattttgttgagaa 221  Q
    ||| |||  ||||| ||||||| ||| ||||||||||||||||||| |||||| ||||||| || |||||||| || ||| |||| ||||||| ||||||    
T  28294180 atgaagagcagggaatgattgaatggatttgggatcattatggaagtggagagctacttgtcgccatggatgaaaatttgcaaaatgattttgatgagaa 28294081  T
Q  222 acaagttgagtgtttgatgattgttggattgtggtgtgctcatcctgatgt 272  Q
    | |||| ||||| ||||||||||||||||||||||||||||||||||||||    
T  28294080 agaagtagagtgcttgatgattgttggattgtggtgtgctcatcctgatgt 28294030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University