View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0744_low_25 (Length: 252)

Name: NF0744_low_25
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0744_low_25
NF0744_low_25
[»] chr8 (1 HSPs)
chr8 (26-224)||(43454642-43454840)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 224
Target Start/End: Original strand, 43454642 - 43454840
Alignment:
Q  26 tgtttcatgattacagttattgaaacaaactataacttttatagcactctggcagataataggtttcttattttatctattatagttgtttacatattta 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||    
T  43454642 tgtttcatgattacagttattgaaacaaactataacttttatagcactctggcagataatagatttcttattttatctgttatagttgtttacatattta 43454741  T
Q  126 tttccttaaaatcaccagaaaataaattaccgcagactgaaactctccatttatgcaattacctagagggagacttgggtgtgtgagcatgagttagat 224  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  43454742 tttccttaaaaccaccagaaaataaattaccgcagactgaaactctccatttatgcaattacctagagggagacttgggtgtgtgagcatgagctagat 43454840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University