View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0743_low_161 (Length: 203)

Name: NF0743_low_161
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0743_low_161
NF0743_low_161
[»] chr8 (1 HSPs)
chr8 (1-129)||(9051332-9051460)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 9051332 - 9051460
Alignment:
Q  1 ttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttcaaccgatcaaagagactctattaagactgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  9051332 ttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttcaaccgatcaaagagactctattaagactgt 9051431  T
Q  101 ggaagtcgacacatctcaaccttattcat 129  Q
    |||||||||||||||||||||||||||||    
T  9051432 ggaagtcgacacatctcaaccttattcat 9051460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University