View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_179 (Length: 206)

Name: NF0740_low_179
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_179
NF0740_low_179
[»] chr1 (1 HSPs)
chr1 (1-123)||(51755328-51755450)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 51755450 - 51755328
Alignment:
Q  1 aggcctccctttgaaaacaaggtccatttggaaaatacaaatttagggaacataaaagcgtttatatcagaattactgacttgagaaatctcatgaaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51755450 aggcctccctttgaaaacaaggtccatttggaaaatacaaatttagggaacataaaagcgtttatatcagaattactgacttgagaaatctcatgaaatt 51755351  T
Q  101 ttcattgcagtaaatagtataat 123  Q
    |||||||||||||||||||||||    
T  51755350 ttcattgcagtaaatagtataat 51755328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University