View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0737_low_41 (Length: 203)

Name: NF0737_low_41
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0737_low_41
NF0737_low_41
[»] chr1 (1 HSPs)
chr1 (1-81)||(50710179-50710259)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 50710259 - 50710179
Alignment:
Q  1 catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatattcatctca 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  50710259 catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacatctca 50710179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University