View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_49 (Length: 258)

Name: NF0735_low_49
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_49
NF0735_low_49
[»] chr1 (1 HSPs)
chr1 (1-137)||(30079236-30079372)
[»] chr7 (1 HSPs)
chr7 (43-135)||(39485817-39485909)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 30079372 - 30079236
Alignment:
Q  1 ctctaaatgcctcattctgtcctgccaattgaacacatcagcatcttttgcagggtggaaatatgtaggataaggaatcccaaaatcatttgcattccat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  30079372 ctctaaatgcctcattctgtcctgccaattgaacacatcagcatcttttgcagggtggaagtatgtaggataaggaatcccaaaatcatttgcattccat 30079273  T
Q  101 ggactcgactctaccacaagcatggacatattcttcg 137  Q
    |||||||||||||||||||||||||||||||||||||    
T  30079272 ggactcgactctaccacaagcatggacatattcttcg 30079236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 43 - 135
Target Start/End: Original strand, 39485817 - 39485909
Alignment:
Q  43 atcttttgcagggtggaaatatgtaggataaggaatcccaaaatcatttgcattccatggactcgactctaccacaagcatggacatattctt 135  Q
    |||||| || || |||||||| || ||||||||||||||||||||||| |||||||| ||||| || || || |||||||| |||||||||||    
T  39485817 atctttcgcgggatggaaatacgtcggataaggaatcccaaaatcattagcattccaaggactagattcaacaacaagcatagacatattctt 39485909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University