View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_high_47 (Length: 215)

Name: NF0735_high_47
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_high_47
NF0735_high_47
[»] chr4 (1 HSPs)
chr4 (1-186)||(6118964-6119149)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 6119149 - 6118964
Alignment:
Q  1 aaatcgattatgtatgattttaacgaaaatcgtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtga 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6119149 aaatcggttatgtatgattttaacgaaaatcgtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtga 6119050  T
Q  101 tgcttgctttagaaggtgaattttcagaggcggtggttgttgtttgtggcggtgctcaatacggtgcgtttcttgaacggaatacg 186  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6119049 tgctggctttagaaggtgaattttcagaggcggtggttgttgtttgtggcggtgctcaatacggtgcgtttcttgaacggaatacg 6118964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University