View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_62 (Length: 323)

Name: NF0733_low_62
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_62
NF0733_low_62
[»] chr5 (1 HSPs)
chr5 (103-222)||(33129995-33130112)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 33130112 - 33129995
Alignment:
Q  103 atctaccccacgggaaaattgaatacttaagcaaatgcccctttggttatcattttaactcataaaaattccattgcatatgactcaattcaagaaaata 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||||||||||||||||||||||| |||||||||    
T  33130112 atctaccccacgggaaaattgaatacttaagcaaatgcccctttggttatcattttaactc--aaagattccattgcatatgactcaatttaagaaaata 33130015  T
Q  203 tacagttaccagaatatatt 222  Q
    ||||||||||||||||||||    
T  33130014 tacagttaccagaatatatt 33129995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University