View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_45 (Length: 355)

Name: NF0733_low_45
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_45
NF0733_low_45
[»] chr4 (1 HSPs)
chr4 (8-192)||(1025389-1025571)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 8 - 192
Target Start/End: Original strand, 1025389 - 1025571
Alignment:
Q  8 tgatctcaacatttacaacaaccatatccatgttatgctgaatatcttactnnnnnnnnnnngttatgctgaatatcaaccagaaaaatagtgttgctgt 107  Q
    |||| ||||||||||||||||||||||||| ||||| ||||||||||||||           ||||||||||||||||||||||||||||||||||||||    
T  1025389 tgatgtcaacatttacaacaaccatatccaagttattctgaatatcttactaaaaaaaaa--gttatgctgaatatcaaccagaaaaatagtgttgctgt 1025486  T
Q  108 tttattatgattttttgtcctcgaaatcataacataaagtatcgcaaaaacaatcagaattaaaaattcacctacatggtatcgt 192  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  1025487 tttattatgattttttgtcctcgaaatcataatataaagtatcgcaaaaataatcagaattaaaaattcacctacatggtatcgt 1025571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University