View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0730_low_26 (Length: 257)

Name: NF0730_low_26
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0730_low_26
NF0730_low_26
[»] chr4 (1 HSPs)
chr4 (132-173)||(28447982-28448023)
[»] chr2 (1 HSPs)
chr2 (135-173)||(18690607-18690645)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 132 - 173
Target Start/End: Original strand, 28447982 - 28448023
Alignment:
Q  132 tttgggctttggctggccttggcttcggtgttcctctctctg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28447982 tttgggctttggctggccttggcttcggtgttcctctctctg 28448023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 135 - 173
Target Start/End: Original strand, 18690607 - 18690645
Alignment:
Q  135 gggctttggctggccttggcttcggtgttcctctctctg 173  Q
    ||||||||| |||||||||||||||||||||||||||||    
T  18690607 gggctttggttggccttggcttcggtgttcctctctctg 18690645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University