View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0719_low_32 (Length: 274)

Name: NF0719_low_32
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0719_low_32
NF0719_low_32
[»] chr4 (1 HSPs)
chr4 (121-228)||(9471600-9471706)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 121 - 228
Target Start/End: Original strand, 9471600 - 9471706
Alignment:
Q  121 gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgttaaaagttggggaaaaggtgtcatgtgggatgtggggggaat 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  9471600 gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgtt-aaagttggggaaaaggtgtcatgtgggatgtggggggaat 9471698  T
Q  221 aggatgat 228  Q
    ||||||||    
T  9471699 aggatgat 9471706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University