View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_low_74 (Length: 240)

Name: NF0713_low_74
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_low_74
NF0713_low_74
[»] chr8 (1 HSPs)
chr8 (1-149)||(13473660-13473808)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 13473808 - 13473660
Alignment:
Q  1 aaacttcctgtcaaatctgttaagcggtttacatgcgttcgcaaaccatggtcacctttgtttggcaatcctactttcctaaccatgttccgcaacaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  13473808 aaacttcctgtcaaatctgttaagcggtttacatgcgttcgtaaaccatggtcacttttgtttggcaatcctactttcctaaccatgttccgcaacaatt 13473709  T
Q  101 tggtttccaaatcccattcattgtatgatgacgacgacgatgatgatgt 149  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||    
T  13473708 tggtttccaaatcccattcattgtatgatgacgacgacgacgatgatgt 13473660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University