View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_low_67 (Length: 208)

Name: NF0707_low_67
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_low_67
NF0707_low_67
[»] chr8 (1 HSPs)
chr8 (75-119)||(12508857-12508901)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 75 - 119
Target Start/End: Original strand, 12508857 - 12508901
Alignment:
Q  75 tttggatttgagtgttgttttggaagtggagtttatattattgga 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  12508857 tttggatttgagtgttgttttggaagtggagtttatattattgga 12508901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University