View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_2D_high_15 (Length: 257)

Name: NF0707_2D_high_15
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_2D_high_15
NF0707_2D_high_15
[»] chr2 (2 HSPs)
chr2 (98-254)||(44671208-44671364)
chr2 (1-106)||(44671070-44671175)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 98 - 254
Target Start/End: Original strand, 44671208 - 44671364
Alignment:
Q  98 gggtttcaactgatgtgtagctgcaattgaaaatcttgaaactatcttcgatggaaaaaggcaatggctgttgcttctctaatttatcttcaattgccac 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  44671208 gggtttcaactgatgtgtagctgcaattgaaaatcttgaaactatcttcgatggaaaaaggcaatggctgttgcttctctagtttatcttcaattgccac 44671307  T
Q  198 cctttcaagtgtggcttttgttgtcatcttgatcttggttcgtgatgtccatctcat 254  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||    
T  44671308 cctttcaagtgtggcttttgttgtcatcttgatcttggttcgtgttgttcatgtcat 44671364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 44671175 - 44671070
Alignment:
Q  1 tttactgctagcttttccttttcaggaccaacaacacacctctctcactgcacaaacaaacaatattataagtctataacaaatgaggatgctagagggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44671175 tttactgctagcttttccttttcaggaccaacaacacacctctctcactgcacaaacaaacaatattataagtctataacaaatgaggatgctagagggg 44671076  T
Q  101 tttcaa 106  Q
    ||||||    
T  44671075 tttcaa 44671070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University