View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0705_low_5 (Length: 403)

Name: NF0705_low_5
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0705_low_5
NF0705_low_5
[»] chr7 (1 HSPs)
chr7 (297-391)||(44781170-44781264)
[»] chr1 (1 HSPs)
chr1 (291-331)||(44318377-44318417)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 297 - 391
Target Start/End: Complemental strand, 44781264 - 44781170
Alignment:
Q  297 atatactcgatttgaaaaatttatccaaattccccaaaactctattttaatacaattttttaatcttgcaaataaaggagatcatttacaagaat 391  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  44781264 atatactcgatttgaaaaatttacccaaattccccaaaactctcttttaatacaattttttaatcttgcaaattaaggagatcatttacaagaat 44781170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 291 - 331
Target Start/End: Complemental strand, 44318417 - 44318377
Alignment:
Q  291 aacaatatatactcgatttgaaaaatttatccaaattcccc 331  Q
    ||||||||||| | |||||||||||||||||||||| ||||    
T  44318417 aacaatatatattggatttgaaaaatttatccaaatccccc 44318377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University