View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0695_low_14 (Length: 258)

Name: NF0695_low_14
Description: NF0695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0695_low_14
NF0695_low_14
[»] chr1 (1 HSPs)
chr1 (30-258)||(3844740-3844968)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 3844740 - 3844968
Alignment:
Q  30 taattctttgtgatcgatgaaaatgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaatgat 129  Q
    |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  3844740 taatcctttgtgatcgatgaaaacgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaacgat 3844839  T
Q  130 atttattcgccaaccagattacagtgacaccaggttttgtattttctcttgaaatgggatttgatttctgacagacaaaaacaaaatctcccttgtggtt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  3844840 atttattcgccaaccagattacagtgacaccaggttttgtattttctattgaaatgggatttgatttctgacagacaaaaacaaaatctccgttgtggtt 3844939  T
Q  230 ccacatacacagggatattgatgctgctt 258  Q
    |||||||||||||||||||||||||||||    
T  3844940 ccacatacacagggatattgatgctgctt 3844968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University