View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_98 (Length: 213)

Name: NF0688_low_98
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_98
NF0688_low_98
[»] chr4 (1 HSPs)
chr4 (1-126)||(52831852-52831977)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 52831977 - 52831852
Alignment:
Q  1 agagaaagttaaagatgccatgcttcatgcatggacatcttatgaaaaatatgcctggggcaaggatgaacttaaggtgcttttccatttgttttgtatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52831977 agagaaagttaaagatgccatgcttcatgcatggacatcttatgaaaaatatgcctggggcaaggatgaacttaaggtgcttttccatttgttttgtatt 52831878  T
Q  101 ttgtttatctacttcttgatgatgtc 126  Q
    |||||||||||||||||||| |||||    
T  52831877 ttgtttatctacttcttgattatgtc 52831852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University