View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_55 (Length: 284)

Name: NF0688_low_55
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_55
NF0688_low_55
[»] chr3 (1 HSPs)
chr3 (30-241)||(40330478-40330689)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 30 - 241
Target Start/End: Original strand, 40330478 - 40330689
Alignment:
Q  30 tactatggctgctatactatgtctatgatcatgttacacaagtaatagttattgtgtctttgattattttaaaatagtaactatttttgtaactgctttt 129  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  40330478 tactatggctgctaaactatttctatgatcatgttacacaagtaatagttaatgtgtctttgattattttaaaatagtaactatttttgtaactgctttt 40330577  T
Q  130 taaattagcnnnnnnnnnngtctatgatcatgttactcaagttaatagtttacaacatcaaataccaattatcaacaatagcattaaacaaattgttttc 229  Q
    |||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40330578 taaattagcttttttttttgtctatgatcatgttactcaagttaatagtttacaacatcaaataccaattatcaacaatagcattaaacaaattgttttc 40330677  T
Q  230 taattgttgacc 241  Q
    ||||||||||||    
T  40330678 taattgttgacc 40330689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University