View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_53 (Length: 296)

Name: NF0688_low_53
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_53
NF0688_low_53
[»] chr3 (1 HSPs)
chr3 (75-239)||(47885610-47885774)
[»] chr1 (1 HSPs)
chr1 (100-234)||(4623320-4623454)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 75 - 239
Target Start/End: Original strand, 47885610 - 47885774
Alignment:
Q  75 attttggacagccgtcagtaaatcatttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtct 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47885610 attttggacagccgtcagtaaatcatttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtct 47885709  T
Q  175 atcttgtacttctgacacaagtctaacatatcatcagcatccttatagttgaaattccctctctg 239  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||    
T  47885710 atcttgtacttctgacacaagtccaacatatcatcagcatccttatagttgaaattccctttctg 47885774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 100 - 234
Target Start/End: Complemental strand, 4623454 - 4623320
Alignment:
Q  100 tttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtctatcttgtacttctgacacaagtcta 199  Q
    ||||||||||| || |||||||||||||||||  | |  || |||||||| ||||| || ||||||||| | |  |||||||||||||||||||||  ||    
T  4623454 tttttattcagcgacttgacccattgttgaacggttccatccacttcccaaaagatgcagtgtccacgagtttggatcttgtacttctgacacaaggtta 4623355  T
Q  200 acatatcatcagcatccttatagttgaaattccct 234  Q
    | | ||||||||| || || || || |||||||||    
T  4623354 aaagatcatcagcgtctttgtaattcaaattccct 4623320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University