View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_123 (Length: 215)

Name: NF0684_low_123
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_123
NF0684_low_123
[»] chr7 (1 HSPs)
chr7 (1-126)||(47196661-47196786)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 47196786 - 47196661
Alignment:
Q  1 ttactaagtttttgtacgtaataatcaaaattagttcatttccttctctctgtactattttttgtttctgtttatttttcctatatgccaaacttagaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47196786 ttactaagtttttgtacgtaataatcaaaattagttcatttccttctctctgtactattttttgtttctgtttatttttcctatatgccaaacttagaga 47196687  T
Q  101 tcaacacgaactgttatttgatgatg 126  Q
    ||||||||||||||||||||||||||    
T  47196686 tcaacacgaactgttatttgatgatg 47196661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University