View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0680_low_19 (Length: 267)

Name: NF0680_low_19
Description: NF0680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0680_low_19
NF0680_low_19
[»] chr2 (1 HSPs)
chr2 (1-238)||(5190841-5191078)


Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5190841 - 5191078
Alignment:
Q  1 agcagttcaaagaattgtccagcaagaaaacaagttgaaagaaaccacatggaccccaccgtactcctcgtaacatacacctccgatcacaaccacgccg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  5190841 agcagttcaaagaattgtccagcaagaaaacaagttgaaagaaaccacatggaccccaccgtactccttgtaacatacacctccgatcacaaccacgccg 5190940  T
Q  101 tgccaccaccgagaaactaccgcaacacaagcaacaacaccgcatcaaacaaagactccgaatcagaacaagaaccagatgaaacgttcacgaatattga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5190941 tgccaccaccgagaaactaccgcaacacaagcaacaacaccgcatcaaacaaagactccgaatcagaacaagaaccagatgaaacgttcacgaatattga 5191040  T
Q  201 agaaaattcaatgatttccaccggtgatgagttaggag 238  Q
    |||||||||||||||| |||||||||||||||||||||    
T  5191041 agaaaattcaatgattgccaccggtgatgagttaggag 5191078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University