View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0678_low_38 (Length: 287)

Name: NF0678_low_38
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0678_low_38
NF0678_low_38
[»] scaffold0029 (2 HSPs)
scaffold0029 (63-243)||(115703-115882)
scaffold0029 (75-243)||(93878-94045)
[»] chr6 (11 HSPs)
chr6 (63-243)||(34642712-34642891)
chr6 (75-233)||(18797678-18797835)
chr6 (71-236)||(19437986-19438150)
chr6 (75-243)||(14377042-14377209)
chr6 (94-243)||(10465974-10466122)
chr6 (71-198)||(19456007-19456133)
chr6 (71-198)||(19466152-19466278)
chr6 (75-237)||(24367388-24367549)
chr6 (71-243)||(24515540-24515711)
chr6 (75-154)||(21567205-21567284)
chr6 (72-200)||(21474585-21474712)
[»] chr7 (21 HSPs)
chr7 (65-243)||(12712631-12712808)
chr7 (75-243)||(14283342-14283509)
chr7 (71-243)||(13676561-13676732)
chr7 (111-243)||(18050921-18051052)
chr7 (75-243)||(13024458-13024625)
chr7 (75-243)||(21755526-21755693)
chr7 (75-230)||(13965649-13965803)
chr7 (94-243)||(12459761-12459909)
chr7 (75-205)||(14140793-14140922)
chr7 (180-242)||(14144879-14144941)
chr7 (102-243)||(15099571-15099711)
chr7 (75-243)||(16947440-16947607)
chr7 (72-243)||(12798469-12798639)
chr7 (75-237)||(26091772-26091933)
chr7 (75-237)||(26115564-26115725)
chr7 (72-237)||(19150122-19150286)
chr7 (72-237)||(20749521-20749685)
chr7 (132-237)||(40924791-40924895)
chr7 (75-154)||(11385485-11385564)
chr7 (75-237)||(49155415-49155576)
chr7 (72-200)||(14261257-14261384)
[»] scaffold0235 (2 HSPs)
scaffold0235 (75-243)||(8446-8613)
scaffold0235 (75-243)||(18660-18827)
[»] scaffold0114 (1 HSPs)
scaffold0114 (75-237)||(40211-40372)
[»] scaffold0348 (2 HSPs)
scaffold0348 (94-243)||(4833-4981)
scaffold0348 (75-243)||(17468-17635)
[»] scaffold0420 (1 HSPs)
scaffold0420 (75-243)||(8767-8934)
[»] chr2 (6 HSPs)
chr2 (71-243)||(23274344-23274515)
chr2 (111-243)||(12577144-12577275)
chr2 (75-243)||(19716538-19716705)
chr2 (75-243)||(19721101-19721268)
chr2 (75-237)||(20848344-20848505)
chr2 (75-154)||(23097627-23097706)
[»] scaffold0222 (2 HSPs)
scaffold0222 (78-243)||(471-635)
scaffold0222 (71-244)||(20963-21135)
[»] scaffold0203 (1 HSPs)
scaffold0203 (71-243)||(838-1009)
[»] chr3 (22 HSPs)
chr3 (75-243)||(16831737-16831904)
chr3 (102-243)||(16384581-16384721)
chr3 (111-243)||(8744599-8744730)
chr3 (71-243)||(12357736-12357907)
chr3 (111-243)||(13944813-13944944)
chr3 (75-243)||(16326918-16327085)
chr3 (71-243)||(18131556-18131727)
chr3 (71-243)||(31941652-31941823)
chr3 (71-243)||(31692394-31692565)
chr3 (71-202)||(17494396-17494526)
chr3 (71-243)||(11949134-11949305)
chr3 (75-243)||(11958390-11958557)
chr3 (71-151)||(12181093-12181173)
chr3 (72-243)||(35982931-35983101)
chr3 (72-203)||(16825528-16825658)
chr3 (72-243)||(17189124-17189294)
chr3 (75-237)||(10408721-10408882)
chr3 (75-237)||(47126697-47126858)
chr3 (132-237)||(28757129-28757233)
chr3 (75-243)||(10417254-10417421)
chr3 (75-243)||(24190057-24190224)
chr3 (158-243)||(13317778-13317863)
[»] scaffold0317 (1 HSPs)
scaffold0317 (71-243)||(2780-2951)
[»] scaffold0072 (1 HSPs)
scaffold0072 (71-243)||(54196-54367)
[»] scaffold0020 (2 HSPs)
scaffold0020 (71-243)||(98567-98738)
scaffold0020 (166-243)||(176230-176307)
[»] chr8 (8 HSPs)
chr8 (75-243)||(22054053-22054220)
chr8 (75-243)||(22027704-22027871)
chr8 (75-243)||(16268648-16268815)
chr8 (94-202)||(29300891-29300998)
chr8 (79-243)||(31413956-31414119)
chr8 (132-237)||(28984158-28984262)
chr8 (166-237)||(22374149-22374220)
chr8 (166-243)||(21928708-21928785)
[»] chr5 (8 HSPs)
chr5 (111-243)||(17266497-17266628)
chr5 (75-243)||(23078068-23078235)
chr5 (75-237)||(25851110-25851271)
chr5 (75-242)||(22505717-22505883)
chr5 (72-243)||(23563331-23563501)
chr5 (75-237)||(14884160-14884321)
chr5 (99-237)||(20345344-20345481)
chr5 (75-243)||(20824491-20824658)
[»] scaffold0765 (1 HSPs)
scaffold0765 (102-243)||(6241-6381)
[»] scaffold0034 (2 HSPs)
scaffold0034 (74-243)||(1936-2104)
scaffold0034 (114-243)||(70564-70692)
[»] scaffold0310 (1 HSPs)
scaffold0310 (75-243)||(11130-11297)
[»] scaffold0239 (1 HSPs)
scaffold0239 (75-243)||(9771-9938)
[»] scaffold0067 (4 HSPs)
scaffold0067 (75-243)||(49164-49331)
scaffold0067 (75-243)||(58198-58365)
scaffold0067 (75-243)||(64586-64753)
scaffold0067 (75-243)||(29777-29944)
[»] chr4 (14 HSPs)
chr4 (111-243)||(53750451-53750582)
chr4 (75-243)||(20893155-20893322)
chr4 (111-243)||(51603773-51603904)
chr4 (78-243)||(7357394-7357558)
chr4 (72-237)||(14993354-14993518)
chr4 (77-243)||(16150762-16150927)
chr4 (77-243)||(16154908-16155073)
chr4 (75-230)||(11204226-11204380)
chr4 (102-243)||(15266927-15267067)
chr4 (114-243)||(27903548-27903676)
chr4 (75-237)||(3261781-3261942)
chr4 (75-237)||(44658853-44659014)
chr4 (132-237)||(29450524-29450628)
chr4 (139-243)||(18259629-18259732)
[»] chr1 (13 HSPs)
chr1 (75-243)||(21961197-21961364)
chr1 (75-243)||(52988911-52989078)
chr1 (111-243)||(20074762-20074893)
chr1 (75-243)||(24096668-24096835)
chr1 (71-243)||(20832953-20833124)
chr1 (72-243)||(22015798-22015968)
chr1 (71-243)||(19857440-19857611)
chr1 (75-237)||(38909885-38910046)
chr1 (75-237)||(48426043-48426204)
chr1 (94-243)||(20297572-20297720)
chr1 (72-243)||(21742605-21742775)
chr1 (75-237)||(37680219-37680380)
chr1 (157-230)||(31537063-31537136)
[»] scaffold0108 (1 HSPs)
scaffold0108 (72-243)||(50255-50425)
[»] scaffold1426 (1 HSPs)
scaffold1426 (75-243)||(1591-1758)
[»] scaffold0706 (1 HSPs)
scaffold0706 (71-243)||(5193-5364)
[»] scaffold0167 (1 HSPs)
scaffold0167 (71-243)||(5202-5373)
[»] scaffold0139 (1 HSPs)
scaffold0139 (71-175)||(19021-19124)
[»] scaffold0058 (1 HSPs)
scaffold0058 (78-198)||(22278-22397)
[»] scaffold0010 (2 HSPs)
scaffold0010 (71-243)||(39317-39488)
scaffold0010 (114-243)||(180823-180951)
[»] scaffold0004 (1 HSPs)
scaffold0004 (71-243)||(325856-326027)
[»] scaffold0156 (1 HSPs)
scaffold0156 (72-243)||(37089-37259)
[»] scaffold0023 (1 HSPs)
scaffold0023 (77-243)||(164385-164550)
[»] scaffold0708 (1 HSPs)
scaffold0708 (75-243)||(5129-5296)
[»] scaffold0118 (1 HSPs)
scaffold0118 (75-243)||(614-781)
[»] scaffold0005 (1 HSPs)
scaffold0005 (75-243)||(263379-263546)
[»] scaffold0003 (1 HSPs)
scaffold0003 (75-243)||(203534-203701)
[»] scaffold0523 (2 HSPs)
scaffold0523 (72-243)||(5590-5760)
scaffold0523 (72-237)||(11733-11897)
[»] scaffold0046 (1 HSPs)
scaffold0046 (72-243)||(70258-70428)
[»] scaffold0146 (1 HSPs)
scaffold0146 (72-202)||(309-438)
[»] scaffold0367 (1 HSPs)
scaffold0367 (71-243)||(9005-9176)
[»] scaffold0076 (1 HSPs)
scaffold0076 (75-243)||(53407-53574)
[»] scaffold1517 (1 HSPs)
scaffold1517 (75-202)||(1512-1638)
[»] scaffold0056 (1 HSPs)
scaffold0056 (72-243)||(867-1037)
[»] scaffold0054 (1 HSPs)
scaffold0054 (72-243)||(63503-63673)
[»] scaffold0001 (1 HSPs)
scaffold0001 (75-242)||(514338-514504)
[»] scaffold1433 (1 HSPs)
scaffold1433 (94-243)||(1295-1443)
[»] scaffold0404 (1 HSPs)
scaffold0404 (94-243)||(7916-8064)
[»] scaffold0190 (1 HSPs)
scaffold0190 (75-176)||(30377-30477)
[»] scaffold0035 (1 HSPs)
scaffold0035 (94-243)||(5977-6125)
[»] scaffold0243 (1 HSPs)
scaffold0243 (71-243)||(9756-9927)
[»] scaffold2165 (1 HSPs)
scaffold2165 (111-242)||(788-918)
[»] scaffold1032 (1 HSPs)
scaffold1032 (72-243)||(799-969)
[»] scaffold0106 (1 HSPs)
scaffold0106 (72-243)||(34487-34657)
[»] scaffold0309 (1 HSPs)
scaffold0309 (72-242)||(12877-13046)
[»] scaffold2062 (1 HSPs)
scaffold2062 (72-243)||(856-1031)
[»] scaffold0335 (1 HSPs)
scaffold0335 (75-243)||(4288-4455)
[»] scaffold0476 (1 HSPs)
scaffold0476 (75-154)||(617-696)
[»] scaffold0165 (1 HSPs)
scaffold0165 (72-243)||(12110-12280)
[»] scaffold0053 (2 HSPs)
scaffold0053 (72-203)||(62796-62926)
scaffold0053 (75-145)||(65379-65449)
[»] scaffold0011 (2 HSPs)
scaffold0011 (71-130)||(151716-151775)
scaffold0011 (158-243)||(153727-153812)
[»] scaffold0074 (1 HSPs)
scaffold0074 (129-202)||(15279-15351)
[»] scaffold0041 (1 HSPs)
scaffold0041 (132-237)||(41945-42049)
[»] scaffold1299 (1 HSPs)
scaffold1299 (75-154)||(1920-1999)
[»] scaffold0751 (1 HSPs)
scaffold0751 (72-243)||(5331-5501)
[»] scaffold0104 (1 HSPs)
scaffold0104 (72-243)||(43403-43573)
[»] scaffold0079 (1 HSPs)
scaffold0079 (130-233)||(36706-36808)
[»] scaffold1530 (1 HSPs)
scaffold1530 (71-136)||(732-797)
[»] scaffold0088 (1 HSPs)
scaffold0088 (111-243)||(30123-30254)
[»] scaffold0009 (1 HSPs)
scaffold0009 (75-243)||(251775-251939)
[»] scaffold0443 (1 HSPs)
scaffold0443 (184-237)||(12058-12111)
[»] scaffold0405 (1 HSPs)
scaffold0405 (184-237)||(5863-5916)
[»] scaffold0276 (1 HSPs)
scaffold0276 (184-237)||(23913-23966)
[»] scaffold0266 (1 HSPs)
scaffold0266 (102-243)||(16817-16957)
[»] scaffold0068 (1 HSPs)
scaffold0068 (79-243)||(67092-67255)


Alignment Details
Target: scaffold0029 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 63 - 243
Target Start/End: Original strand, 115703 - 115882
Alignment:
Q  63 tcatttgcggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattg 162  Q
    ||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
T  115703 tcatttgtggtttgcataccagccaaggcaaacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc-cccattg 115801  T
Q  163 cagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||    
T  115802 caattatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaagcacttcttctca 115882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 94045 - 93878
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | ||||| || || ||||| |||||||| |||||||||||||| ||||| || ||||||||||| |   |||||| | ||     
T  94045 tgcgtaccagtcaaagcaaatacttttcctccagtcctgaccttcttaggttgagtgcactgcgaactaatgtgaccctcatc-accacagttaaaacaa 93947  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| |||||||||||||| || ||||| ||||| ||||| || || |||||||| ||| |||||    
T  93946 acaatatctccacgcttgcaatccgccaacacatgacctttctgaccgcatctgaaacatttcttctca 93878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 63 - 243
Target Start/End: Complemental strand, 34642891 - 34642712
Alignment:
Q  63 tcatttgcggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattg 162  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
T  34642891 tcattcgcggtttgcgtaccagccaaggcaaacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc-cccattg 34642793  T
Q  163 cagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||||| |||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||| |||||    
T  34642792 cagttgtagcatacaatatcaccacgtttacaatcagctaacacgtgacccttctgtccacacctgaagcacttcttctca 34642712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 75 - 233
Target Start/End: Original strand, 18797678 - 18797835
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||| || |||| ||||||||||||||||     
T  18797678 tgcgtaccagtcaatgcaaacactttcccaccggttctaaccttctttggttgagtgcactgtgaactgatatggccttcat-cattgcagttatagcaa 18797776  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaaca 233  Q
    || |  ||||||||||||||||||||||    ||| |||||||| ||||||||||||||    
T  18797777 acaacgtcaccacgcttgcaatcagctagagtgtgtcccttctgaccacacctgaaaca 18797835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 71 - 236
Target Start/End: Original strand, 19437986 - 19438150
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| |||| || ||||  ||||||||||||||||| || |||||||| ||||||||||| | ||| | | |||||||||||    
T  19437986 ggtttgcgtaccagtcagagcaaacaccttaccactagtcctaaccttcttcggctgtgtgcactgcgaactgatatggcgctc-ttcgttgcagttata 19438084  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacactt 236  Q
     ||||| | |||||||||||||||||||||||    ||| || ||||| |||||||||||||||||    
T  19438085 acatacaacatcaccacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaaacactt 19438150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 14377209 - 14377042
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| |||||||| |||||||||||||| || || || || |||||||| || ||||| | ||||||||||||| ||     
T  14377209 tgcgtaccagtcaatgcaaacacttttccaccggttctaaccttcttcggctgtgtacattgcgaactgatgtggccctc-ttcattgcagttataacaa 14377111  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||||||| |||| ||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  14377110 acaacatcaccacgcttacaattagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 14377042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 243
Target Start/End: Complemental strand, 10466122 - 10465974
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    |||||||||| |||||||| ||||||||||| ||||| ||||| ||||| |||||||| || | |||||||||||||||| || || || |||||||| |    
T  10466122 acactttccctccggtcctgaccttcttcggctgagtacactgtgaactaatatgaccttc-ttcattgcagttatagcagacaatgtccccacgcttac 10466024  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | |||||||    ||| |||||||| |||||||| ||||| ||| |||||    
T  10466023 attcagctagggtgtgtcccttctgaccacacctaaaacatttcctctca 10465974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 71 - 198
Target Start/End: Original strand, 19456007 - 19456133
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||| |||||||| ||||  ||||| |||||||| || | | |||||||||||    
T  19456007 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttctttggttgagtacactacgaactaatatgaccttcct-cgttgcagttata 19456105  T
Q  171 gcatactatatcaccacgcttgcaatca 198  Q
    ||| || || || |||||||| ||||||    
T  19456106 gcaaacaatgtctccacgcttacaatca 19456133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 71 - 198
Target Start/End: Original strand, 19466152 - 19466278
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||| |||||||| ||||  ||||| |||||||| || | | |||||||||||    
T  19466152 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttctttggttgagtacactacgaactaatatgaccttcct-cgttgcagttata 19466250  T
Q  171 gcatactatatcaccacgcttgcaatca 198  Q
    ||| || || || |||||||| ||||||    
T  19466251 gcaaacaatgtctccacgcttacaatca 19466278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 24367388 - 24367549
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| |||||||| || |||   |||||||||| || |||||| ||||| |||||||| || ||||||||| || || ||     
T  24367388 tgcgtaccagtcaaagcaaacaccttcccaccagttctagttttcttcggttcagggcactgtgaactaatatgaccttc-tccattgcaattgtaacag 24367486  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || || |||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  24367487 acaatgtccccccgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 24367549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 24515711 - 24515540
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  | | |||| || ||||||||||||||| || ||||||| || ||||| |||||||| ||||| || | |||||||||||||    
T  24515711 ggtttgcgtaccagtcagagaaaacacgttaccaccggtcctaaccgtcctcggttgcgtacactgcgaactgatgtgaccttcct-cattgcagttata 24515613  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | ||| || | ||| ||||||||||    ||| |  ||||| |||||||||||||||||| |||||    
T  24515612 acaaacaacatctcccctcttccaatcagctagtgtgtgtcttttctgaccacacctgaaacacttcttctca 24515540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 21567284 - 21567205
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc 154  Q
    |||||||||| ||| ||| ||||||| |||||||| |||| |||||| || ||||||||||| |||||||| || |||||    
T  21567284 tgcgtaccagtcaaagcaaacacttttccaccggttctaatcttctttggctgagtgcactgggaactgatgtggccctc 21567205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 200
Target Start/End: Original strand, 21474585 - 21474712
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| |||  | ||||||| ||||   ||||||||||||| ||||||||||| | |||  || || |||    
T  21474585 gtttgcgtaccagtcaaagcaaacaccttgccacctgtcagagccttcttaggtttcctgcactgagaactaatatgaccctc-ttcatcacaattgtag 21474683  T
Q  172 catactatatcaccacgcttgcaatcagc 200  Q
    || || ||||||||||||||||| |||||    
T  21474684 cacacaatatcaccacgcttgcactcagc 21474712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 21)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 65 - 243
Target Start/End: Complemental strand, 12712808 - 12712631
Alignment:
Q  65 atttgcggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgca 164  Q
    ||||| |||||||||||| ||||||||| |||||||||| | |||||||||||||||| ||||||||||||||||| |||||||||||||  ||||||||    
T  12712808 atttgtggtttgcgtacccgccaaggcaaacactttcccgctggtcctaaccttcttccgttgagtgcactgagaattgatatgaccctcc-ccattgca 12712710  T
Q  165 gttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||    
T  12712709 gttatagcatacaatatcaccacgtttgcaatcagctaacacgtgacccttctgtccacacctgaagcacttcttctca 12712631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 14283509 - 14283342
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||| || | |||||| |  |||||||||||||| ||  ||||||||||| |||    
T  14283509 tgcgtaccagtcaaagcaaacactttcccaccggttctaaccttcttcggctgtgggcactgtgtgctgatatgaccctcttcg-ttgcagttataacat 14283411  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | ||||||||||||||||||||||||   |||||||||||| ||||||||||| |||||| |||||    
T  14283410 acaacatcaccacgcttgcaatcagctaatgtgtgacccttctgaccacacctgaagcacttcttctca 14283342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 13676561 - 13676732
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||| ||||||||||||||||| |  ||||| ||||||||||| ||||| | |||||||||||||    
T  13676561 ggtttgcgtaccagtcagagcaaacactttaccaccggttctaaccttcttcggttgtgcacactgtgaactgatatggccctcct-cattgcagttata 13676659  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| ||||| || || ||||| |||||||||||   ||| ||||||||||||||||||||  ||||| |||||    
T  13676660 gcaaactatgtctccccgcttacaatcagctaatgtgtgtcccttctgtccacacctgaagtacttcttctca 13676732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 18051052 - 18050921
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| |||||||| || ||| || ||||| ||||| | |||||| ||||||||||| |||| || ||||    
T  18051052 ctaaccttcttcggctgtgtgcactgagtactgatgtgaccctcttc-attacaattataacatacaacatcaccgcgcttgcaatcggctagcatgtga 18050954  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  18050953 cccttctgtccacatctgaaacacttcttctca 18050921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 13024458 - 13024625
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| || | | |||||||| |||||     
T  13024458 tgcgtaccagtcaatgcaaacactttcccaccggtcctagccttcttcggctgagtacactgagaactgatatgaccttc-ttcgttgcagttgtagcag 13024556  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||  |||||||||||||| ||| |||||    
T  13024557 acaatgtctccacgcttacattcagctagggtgtgtcctttctaaccacacctgaaacatttcctctca 13024625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 21755526 - 21755693
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || || || || |||||||||||||| | ||  ||||| || || ||||||||||| |||||||||||| |||||     
T  21755526 tgcgtaccagtcaatgcaaacaccttgcccccagttctaaccttcttcggctcaggacactgtgagctaatatgaccctc-tccattgcagttgtagcag 21755624  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| |||||||| || ||||||||   |||||||||||| |||||||||||||||||| |||||    
T  21755625 acaatatccccacgcttacattcagctaaagtgtgacccttctgaccacacctgaaacacttcctctca 21755693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 75 - 230
Target Start/End: Complemental strand, 13965803 - 13965649
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| |||||||| || ||| |||||||||| | ||  ||||| ||||||||||||||||| ||||||||| || |||||     
T  13965803 tgcgtaccagtcaatgcaaacaccttcccaccagttctagccttcttcggctcaggacactgtgaactgatatgaccctc-tccattgcaattgtagcag 13965705  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaa 230  Q
    || ||||| ||||||||||| |||||||    |||||||||||| |||||||||||    
T  13965704 acaatatccccacgcttgcattcagctagactgtgacccttctgaccacacctgaa 13965649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 243
Target Start/End: Original strand, 12459761 - 12459909
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    |||||||||| |||||||| ||||||||||| ||||| ||||| ||||| |||||||| || | |||||||||||||||| || || || |||||||| |    
T  12459761 acactttccctccggtcctgaccttcttcggctgagtacactgtgaactaatatgaccttc-ttcattgcagttatagcagacaatgtccccacgcttac 12459859  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | |||||||    ||| |||||||| |||||||| ||||| ||| |||||    
T  12459860 attcagctagggtgtgtcccttctgaccacacctaaaacatttcctctca 12459909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 75 - 205
Target Start/End: Original strand, 14140793 - 14140922
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | || |||||||| || |||||||||||||| || |||||||||| |||||| || ||||| | | || || ||||| |||    
T  14140793 tgcgtaccagtcaaagcaaataccttcccaccagttctaaccttcttcggctgtgtgcactgagtactgatgtggccctc-ttcgttacaattataacat 14140891  T
Q  175 actatatcaccacgcttgcaatcagctaaca 205  Q
    || | ||||||||||||||||||||||||||    
T  14140892 acaacatcaccacgcttgcaatcagctaaca 14140922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 14144879 - 14144941
Alignment:
Q  180 atcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctc 242  Q
    |||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| ||||    
T  14144879 atcaccacgcttgcaatcagctaacacgtgacccttttgaccacacctgaagcacttcttctc 14144941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 15099711 - 15099571
Alignment:
Q  102 ccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagct 201  Q
    ||||| ||||||||||||||||| || || ||||| |||||||||||||| || | ||||||||||||| || || || || |||||||| |||||| ||    
T  15099711 ccacctgtcctaaccttcttcggctgcgtacactgcgaactgatatgaccttcct-cattgcagttataacaaacgatgtccccacgcttacaatcatct 15099613  T
Q  202 aacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |    ||| |||||||| ||||||||||| |||||| |||||    
T  15099612 agagtgtgtcccttctgaccacacctgaagcacttcttctca 15099571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 16947607 - 16947440
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||  ||| ||| |||||||||||||||| ||| |||||||| | ||| | ||||| ||||||||||||||||| | | |||||||| |||||     
T  16947607 tgcgtaccattcaatgcaaacactttcccaccggttctagccttcttcagctgaatacactgtgaactgatatgaccctc-ttcgttgcagttgtagcaa 16947509  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||| |||||||| | ||||||| |||||    
T  16947508 acaatgtctccacgcttacattcagctagtgtgtgtcctttctgaccacacctaacacacttcctctca 16947440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 12798639 - 12798469
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | || || ||||| |||||| ||||||| || || || ||||| |||||||||||||| || | |||| ||||| |||    
T  12798639 gtttgcgtaccagtcaacgcaaaaaccttgccacctgtcctagccttcttaggctgtgtacactgcgaactgatatgaccttc-ttcattacagttgtag 12798541  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| |||||||  |||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  12798540 caaacaacatccccacgctcacaatcagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 12798469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 26091933 - 26091772
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  26091933 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 26091835  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  26091834 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 26091772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 26115725 - 26115564
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| || |||  ||||||||||| ||  ||||| | ||| |||||||| || ||||||||| || || ||     
T  26115725 tgcgtaccagtcaaagcaaacacctttccaccagttctagtcttcttcggttcaggacactgtgtactaatatgaccttc-tccattgcaattgtaacag 26115627  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  26115626 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 26115564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 237
Target Start/End: Original strand, 19150122 - 19150286
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | ||||| |||||  ||||| ||||||| ||||| || ||||| ||||| ||||| || || | |||| ||||| |||    
T  19150122 gtttgcgtaccagtcaacgcaaatactttaccacctatcctagccttcttaggttgcgtacactgcgaactaatatgtccttc-ttcattacagttgtag 19150220  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || ||||| ||||||||||||||||| ||   ||| || ||||| |||||||| || ||||||    
T  19150221 caaacaatatctccacgcttgcaatcagccaatgtgtgtcctttctgaccacacctaaagcacttc 19150286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 237
Target Start/End: Original strand, 20749521 - 20749685
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | ||||| |||||  ||||| ||||||| ||||| || ||||| ||||| ||||| || || | |||| ||||| |||    
T  20749521 gtttgcgtaccagtcaacgcaaatactttaccacctatcctagccttcttaggttgcgtacactgcgaactaatatgtccttc-ttcattacagttgtag 20749619  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || ||||| ||||||||||||||||| ||   ||| || ||||| |||||||| || ||||||    
T  20749620 caaacaatatctccacgcttgcaatcagccaatgtgtgtcctttctgaccacacctaaagcacttc 20749685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 132 - 237
Target Start/End: Complemental strand, 40924895 - 40924791
Alignment:
Q  132 cactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaa 231  Q
    ||||| |||||||||||||| ||  ||||||||||| || || || || || ||||||||||| ||||||||   |||||||||||| |||||||||||     
T  40924895 cactgtgaactgatatgaccttcc-ccattgcagttgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaag 40924797  T
Q  232 cacttc 237  Q
    ||||||    
T  40924796 cacttc 40924791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 11385564 - 11385485
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc 154  Q
    |||||||||| ||| ||| |||| |||||||| || |||| |||||| |||||||||||||| |||||||| || |||||    
T  11385564 tgcgtaccagtcaaagcaaacaccttcccaccagttctaatcttctttggttgagtgcactgtgaactgatgtggccctc 11385485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 49155415 - 49155576
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  49155415 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 49155513  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||    ||||||||||| ||||||||||| ||||||    
T  49155514 acaatgtccccacgcttgcattcagctaaactatgacccttctgaccacacctgaagcacttc 49155576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 200
Target Start/End: Complemental strand, 14261384 - 14261257
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | || || ||||| |||||||||||||| || ||  |  |||| ||||| ||||| || || | |||| ||||| |||    
T  14261384 gtttgcgtaccagtcaacgcaaataccttgccacctgtcctaaccttcttaggctgcataaactgcgaactaatatgtccttcct-cattacagttgtag 14261286  T
Q  172 catactatatcaccacgcttgcaatcagc 200  Q
    || || ||||| |||||||||||||||||    
T  14261285 caaacaatatccccacgcttgcaatcagc 14261257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0235 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: scaffold0235
Description:

Target: scaffold0235; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 8613 - 8446
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| |||| || ||||||||||||| ||     
T  8613 tgcgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggttgattgcactgcgaactgatatggccct-attcattgcagttataacaa 8515  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || |  ||||||||||||||||||||||    ||| |||||||| |||||||||||||||||| |||||    
T  8514 acaacgtcaccacgcttgcaatcagctagagtgtgtcccttctgaccacacctgaaacacttcttctca 8446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0235; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 18827 - 18660
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| |||| || ||||||||||||| ||     
T  18827 tgcgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggttgattgcactgcgaactgatatggccct-attcattgcagttataacaa 18729  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || |  ||||||||||||||||||||||    ||| |||||||| |||||||||||||||||| |||||    
T  18728 acaacgtcaccacgcttgcaatcagctagagtgtgtcccttctgaccacacctgaaacacttcttctca 18660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 40211 - 40372
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||| || |||||||||| ||||||||| ||||| | | ||||||||||| |||    
T  40211 tgcgtaccagtcaaagcaaacactttcccaccggttctaaccttcttcggctgtgtgcactgagtactgatatggccctc-ttcgttgcagttataacat 40309  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || | ||||| |||||||||||| ||||||| |||||||||||  ||||||||||| ||||||    
T  40310 acaacatcacaacgcttgcaatccgctaacatgtgacccttctaaccacacctgaagcacttc 40372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0348 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0348
Description:

Target: scaffold0348; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 94 - 243
Target Start/End: Complemental strand, 4981 - 4833
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    ||||||| |||||||| ||||||||| |||| || || ||||||| ||||||||| ||||| ||  ||||||||||| ||||| | ||||||||||||||    
T  4981 acacttttccaccggttctaaccttcctcggctgtgtacactgagtactgatatggccctcctcg-ttgcagttataacatacaacatcaccacgcttgc 4883  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||| |||||||||||||||||||||||| |||||| |||||    
T  4882 aatcagctaacatgtgacccttctgtccacacctgaagcacttcttctca 4833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0348; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 17635 - 17468
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||| ||||||||| || |||||||||||||| || || ||||||| ||||||||| ||||| | | ||||| || || |||    
T  17635 tgcgtaccagtcaaagcaaacattttcccaccagttctaaccttcttcggctgtgtacactgagtactgatatggccctc-ttcgttgcaattgtaacat 17537  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||||| || |||| |||||   ||||||||| ||  ||||||| || |||||| |||||    
T  17536 acaacatcaccacgcatgtaatccgctaatgtgtgacccttttgatcacacctaaagcacttcttctca 17468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0420 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: scaffold0420
Description:

Target: scaffold0420; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 8767 - 8934
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||| || || | | |||||||| |||||     
T  8767 tgcgtaccagtcaatgcaaacactttcccaccggtactaaccttcttcggttgagtgcactgcgaactgatatggccttc-ttcgttgcagttgtagcaa 8865  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||||||||||||||||||||    ||| || ||||| |||||||||||||||||| |||||    
T  8866 acaatgtcaccacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaaacacttcttctca 8934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 23274344 - 23274515
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    ||||||| |||||| ||  ||| ||||||| ||||| |||||||||||||||||||| |||||||| ||||||||||| ||||| | |||||||||||||    
T  23274344 ggtttgcataccagtcagagcaaacactttaccaccagtcctaaccttcttcggttgtgtgcactgtgaactgatatggccctcct-cattgcagttata 23274442  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| ||||| || || ||||| |||||||||||   ||| |||||||||||||||||||| |||||| |||||    
T  23274443 gcaaactatgtctccccgcttacaatcagctaatgtgtgtcccttctgtccacacctgaagcacttcttctca 23274515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 243
Target Start/End: Original strand, 12577144 - 12577275
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| |||||||| || ||| || ||||||||||| | |||||| ||||||||||| |||| || ||||    
T  12577144 ctaaccttcttcggctgtgtgcactgagtactgatgtgaccctcttc-attacaattatagcatacaacatcaccgcgcttgcaatcggctagcatgtga 12577242  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  12577243 cccttctgtccacatctgaaacacttcttctca 12577275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 19716705 - 19716538
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||| || |||||||| ||||||||||| ||||| |   ||||||||||| ||     
T  19716705 tgcgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggctgtgtgcactgcgaactgatatggccctc-tttgttgcagttataacaa 19716607  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | ||||| |||||||||||||||||    ||| || ||||| |||||||||||||||||| |||||    
T  19716606 acaacatcactacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaaacacttcttctca 19716538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 19721268 - 19721101
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||| || |||||||| ||||||||||| ||||| |   ||||||||||| ||     
T  19721268 tgcgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggctgtgtgcactgcgaactgatatggccctc-tttgttgcagttataacaa 19721170  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | ||||| |||||||||||||||||    ||| || ||||| |||||||||||||||||| |||||    
T  19721169 acaacatcactacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaaacacttcttctca 19721101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 20848344 - 20848505
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  20848344 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 20848442  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  20848443 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 20848505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 23097706 - 23097627
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc 154  Q
    |||||||||| ||| ||| |||| |||||||| || |||| |||||| || ||||||||||| |||||||| || |||||    
T  23097706 tgcgtaccagtcaaagcaaacaccttcccaccagttctaatcttctttggctgagtgcactgtgaactgatgtggccctc 23097627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0222 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: scaffold0222
Description:

Target: scaffold0222; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 78 - 243
Target Start/End: Complemental strand, 635 - 471
Alignment:
Q  78 gtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatact 177  Q
    ||||||| ||| ||| ||||||||||| |||| |||||||||||||| || |||||||| ||||||||||| ||||| | |||||||||||||||| ||     
T  635 gtaccagtcaatgcaaacactttcccatcggttctaaccttcttcggctgtgtgcactgtgaactgatatggccctc-ttcattgcagttatagcaaaca 537  T
Q  178 atatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | |||||||||||||||||||||||    ||| || ||||| |||||||||||||||||| |||||    
T  536 acatcaccacgcttgcaatcagctaggctgtgtcctttctgaccacacctgaaacacttcttctca 471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0222; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 71 - 244
Target Start/End: Original strand, 20963 - 21135
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||| ||||||||||||||||| || ||||| ||||||||| | ||||| | |||||||||||||    
T  20963 ggtttgcgtaccagtcagagcaaacactttaccaccggttctaaccttcttcggttgtgtacactgtgaactgatacggccctcct-cattgcagttata 21061  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctcac 244  Q
    ||| | ||| || || ||||| |||||| ||||   ||| |||||||||||||||||||| |||||| ||||||    
T  21062 gcaaattatgtctccccgcttacaatcaactaatgtgtgtcccttctgtccacacctgaagcacttcttctcac 21135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0203 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0203
Description:

Target: scaffold0203; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 1009 - 838
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    ||||||| |||||| ||| ||| ||||||| |||||||| ||||||||| ||||||| || ||||| ||||||||||||||||| | |||||||||||||    
T  1009 ggtttgcataccagtcaaagcaaacactttaccaccggttctaaccttcctcggttgcgtacactgtgaactgatatgaccctc-ttcattgcagttata 911  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || |||||||||||||||||||||||||    ||| || ||||| ||||||||||| |||||| |||||    
T  910 acaaacaatatcaccacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaagcacttcttctca 838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 22)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 16831904 - 16831737
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| || |||||||||||||| || |||||||| | ||||||||| ||||| ||  ||||||||||| |||    
T  16831904 tgcgtaccagtcaaagcaaacacctttccaccagttctaaccttcttcggctgtgtgcactgtgtactgatatggccctcttcg-ttgcagttataacat 16831806  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | ||||||||||||||| || |||||||||||||||||||| ||||||||||| |||||| |||||    
T  16831805 acaacatcaccacgcttgcagtccgctaacacgtgacccttctgaccacacctgaagcacttcttctca 16831737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 16384721 - 16384581
Alignment:
Q  102 ccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagct 201  Q
    ||||| || |||||||||||||| || |||||||||| ||||||||| ||||| || ||| || ||||||||||| | |||||||||||||||||||||     
T  16384721 ccaccagttctaaccttcttcggctgtgtgcactgagtactgatatggccctcttc-attacaattatagcatacaacatcaccacgcttgcaatcagcc 16384623  T
Q  202 aacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||| |||||||||||| ||||||||||| |||||| |||||    
T  16384622 aacatgtgacccttctgaccacacctgaagcacttcttctca 16384581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 8744730 - 8744599
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    ||||||||||||||||| |||||||||| |||||| || ||||| || ||| || ||||||||||| | |||||| ||||||||||| |||| || ||||    
T  8744730 ctaaccttcttcggttgtgtgcactgagtactgatgtggccctcttc-attacaattatagcatacaacatcaccgcgcttgcaatcggctagcatgtga 8744632  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  8744631 cccttctgtccacatctgaaacacttcttctca 8744599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 12357907 - 12357736
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||||||||| || ||||| |||||||||||||| || | |||||||||||||    
T  12357907 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgtgtacactgcgaactgatatgaccttcct-cattgcagttata 12357809  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || |  || || ||||| |||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  12357808 gcaaacaacgtctccccgcttacaatcagctaatgtgtgtcctttctgaccacacctgaagcacttcttctca 12357736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 111 - 243
Target Start/End: Original strand, 13944813 - 13944944
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| || ||||| || ||| || ||||||||||| | |||||| ||||||||||| |||| || ||||    
T  13944813 ctaaccttcttcggctgtgtgcactgagtactgatgtggccctcttc-attacaattatagcatacaacatcaccgcgcttgcaatcggctagcatgtga 13944911  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  13944912 cccttctgtccacatctgaaacacttcttctca 13944944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 16327085 - 16326918
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| || |||||||||||||| | ||| ||||| ||||||||||||||||| |||||||||||| |||||     
T  16327085 tgcgtaccagtcaatgcaaacacctttccaccagttctaaccttcttcggcttagtacactgcgaactgatatgaccctc-tccattgcagttgtagcag 16326987  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || ||||||||   ||| |||||||| |||||||||||||| ||| |||||    
T  16326986 acaatgtccccacgcttacattcagctaaattgtgtcccttctgaccacacctgaaacatttcctctca 16326918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 18131727 - 18131556
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  | | ||||||| |||||||| |||||||||||| ||||||| ||||| ||||| |||||||  || || ||||||||||||    
T  18131727 ggtttgcgtaccagtcagagtaaacactttaccaccggttctaaccttcttcagttgagtacactgcgaactaatatgactttcctc-attgcagttata 18131629  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| |||| ||| |||||||| |||| ||||||  |||| || ||||| ||||||||||| |||||| |||||    
T  18131628 gcacactacatccccacgcttacaattagctaatgcgtgtcctttctgaccacacctgaagcacttcttctca 18131556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 31941652 - 31941823
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||| ||| |||| || ||||| ||||||||||||||||| || || ||||  ||||||||||| ||||| | ||||||| |||||    
T  31941652 ggtttgcgtaccagtcaaagcaaacaccttaccaccagtcctaaccttcttcggctgcgtacactatgaactgatatggccctcct-cattgcaattata 31941750  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | ||||||||||||||| |||||||    ||| |||||||| |||||||||||||||||| |||||    
T  31941751 acaaacaacatcaccacgcttgcagtcagctagagtgtgtcccttctgaccacacctgaaacacttcttctca 31941823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 31692565 - 31692394
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| |||| || ||||| ||||||||||||||||| || || ||||| ||||||||||| ||||| | |||||||||||||    
T  31692565 ggtttgcgtaccagtcagagcaaacaccttaccaccagtcctaaccttcttcggctgcgtacactgtgaactgatatggccctcct-cattgcagttata 31692467  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | |||||||| |||||| |||||||    ||| |||||||  |||||||||||||||||| |||||    
T  31692466 acaaacaacatcaccactcttgcagtcagctagagtgtgtcccttctaaccacacctgaaacacttcttctca 31692394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 71 - 202
Target Start/End: Original strand, 17494396 - 17494526
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| ||||||||||||||||||||||||||||| ||||| ||||| |||||||| || | | |||||||||||    
T  17494396 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgagtacactgcgaactaatatgaccttcct-cgttgcagttata 17494494  T
Q  171 gcatactatatcaccacgcttgcaatcagcta 202  Q
    ||| || || || |||| ||| || |||||||    
T  17494495 gcaaacaatgtctccacacttacagtcagcta 17494526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 11949305 - 11949134
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||| |||||||||||||||  |  || |||||  ||||||| ||||| || || ||||||||||||    
T  11949305 ggtttgcgtaccagtcagagcaaacactttaccaccgatcctaaccttcttcgtctacgtacactgcaaactgatgtgaccttcctc-attgcagttata 11949207  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || | ||| || ||||| ||||||||||| | ||| || ||||| ||||| ||||| |||||| |||||    
T  11949206 gcaaacaacatctccccgcttacaatcagctaatatgtgtcctttctgaccacatctgaagcacttcttctca 11949134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 11958557 - 11958390
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||||||| |||||||||| ||||| ||||  |||||||||||||  || | | |||||||| |||||     
T  11958557 tgcgtaccagtcaatgcaaacactttcccaccggtcctagccttcttcggctgagtacactatgaactgatatgactttc-ttcgttgcagttgtagcag 11958459  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||  ||||||| || |||||||     || || ||||| |||||||||||||||||| |||||    
T  11958458 acaatgtcctcacgcttacattcagctagtgtatgtcctttctgaccacacctgaaacacttcctctca 11958390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 151
Target Start/End: Original strand, 12181093 - 12181173
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgacc 151  Q
    ||||| |||||||| ||| ||| ||||||| |||||||||||||||||||||||||| || ||||  ||||||||||||||    
T  12181093 ggtttacgtaccagtcaaagcaaacactttaccaccggtcctaaccttcttcggttgcgtacactacgaactgatatgacc 12181173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 35982931 - 35983101
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||| ||| ||| ||| |||| || ||||| |||||||||||||| || || || || || ||||| ||||| || || || ||| ||||| |||    
T  35982931 gtttgcgtaacagtcaaagcaaacaccttgccacctgtcctaaccttcttaggctgcgtacaatgcgaactaatatgtccttcctc-attacagttgtag 35983029  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| ||||||||||||||||| ||   ||| || ||||||||||| |||||||||||| |||||    
T  35983030 caaacaatatccccacgcttgcaatcagccaatgtgtgtcctttctgtccacatctgaaacacttcttctca 35983101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 203
Target Start/End: Complemental strand, 16825658 - 16825528
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| |||||||||||||| || || || |||||  ||||||||||||| || | ||||| |||| |||    
T  16825658 gtttgcgtaccagtcaaagcaaacaccttgccacctgtcctaaccttcttaggctgcgtacactgcaaactgatatgaccttcct-cattgaagttgtag 16825560  T
Q  172 catactatatcaccacgcttgcaatcagctaa 203  Q
    || || || || |||||||| |||||||||||    
T  16825559 caaacaatgtccccacgcttacaatcagctaa 16825528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 17189124 - 17189294
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||||||||||||||| |||| |||||| || ||||| ||||| |||||||| || ||||| | |||  || |||||     
T  17189124 gtttgcgtaccagtcaacgcaaacactttcccaccggttctaatcttctttggctgagtacactgtgaactgatgtggccctcct-catcacaattataa 17189222  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | |||||| | |||||| | ||| |||  ||| || ||||| ||||||||||| |||||| |||||    
T  17189223 caaacaacatcaccccacttgcagttagccaacgtgtgtcctttctgaccacacctgaagcacttcttctca 17189294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 10408721 - 10408882
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  10408721 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 10408819  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  10408820 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 10408882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 47126697 - 47126858
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  47126697 tgcgtaccagtcaaagcaaacaccttaccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 47126795  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  47126796 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 47126858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 132 - 237
Target Start/End: Original strand, 28757129 - 28757233
Alignment:
Q  132 cactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaa 231  Q
    ||||| ||||| |||||||| || ||||||||| || || || || || || ||||||||||| ||||||||   |||||||||||| |||||||||||     
T  28757129 cactgtgaactaatatgaccttc-tccattgcaattgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaag 28757227  T
Q  232 cacttc 237  Q
    ||||||    
T  28757228 cacttc 28757233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 10417421 - 10417254
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | ||||| || || || || |||||||| ||||| | |||||| ||||| || ||||||||||| |   |||||| | ||     
T  10417421 tgcgtaccagtcaaagcaaatacttttcctccagttctgaccttcttaggttgcgggcactgcgaactaatgtgaccctcatc-accacagttaaaacaa 10417323  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| |||||||||||||| || ||||| ||||| ||||| || || |||||||| ||| |||||    
T  10417322 acaatatctccacgcttgcaatccgccaacacatgacctttctgaccgcatctgaaacatttcttctca 10417254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 24190057 - 24190224
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| || ||||||||||||| |||| |||||| || ||||| ||||| |||||||| || ||||| | |||  || ||||| ||     
T  24190057 tgcgtaccagtcaacgcaaactctttcccaccggttctaatcttctttggctgagtacactgtgaactgatgtggccctcct-catcacaattataacaa 24190155  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||| | |||||| | ||| |||  ||| || ||||| ||||||||||| |||||| |||||    
T  24190156 acaacatcaccccacttgcagttagccaacgtgtgtcctttctgaccacacctgaagcacttcttctca 24190224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 243
Target Start/End: Complemental strand, 13317863 - 13317778
Alignment:
Q  158 cattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||| |||||||| || || | ||| |||||||||||||| ||||| || ||||| || || ||||| |||||||||||| |||||    
T  13317863 cattacagttataacaaaccacatccccacgcttgcaatccgctaaaacatgacctttttgaccacatctgaaacacttcttctca 13317778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0317 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0317
Description:

Target: scaffold0317; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 2780 - 2951
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||| ||||||||||||||||| |  ||||| ||||||||||| ||||| | |||||||||||||    
T  2780 ggtttgcgtaccagtcagagcaaacactttaccaccggttctaaccttcttcggttgtgcacactgtgaactgatatggccctcct-cattgcagttata 2878  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| ||||| || || ||||| |||||||||||   ||| ||||||||||||||||||||  ||||| |||||    
T  2879 gcaaactatgtctccccgcttacaatcagctaatgtgtgtcccttctgtccacacctgaagaacttcttctca 2951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 54196 - 54367
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    ||||||||||||||  || ||| ||||||| |||| |||||||||||| |||||||| |||||| | || |||||||||||||| | |||||||||||||    
T  54196 ggtttgcgtaccagtgaaagcaaacactttaccactggtcctaacctttttcggttgtgtgcaccgtgagctgatatgaccctc-ttcattgcagttata 54294  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | ||||||||||||||||| |||||    ||| |||||||| |||||||||||||||||| |||||    
T  54295 acaaacaacatcaccacgcttgcaataagctagagtgtgtcccttctgaccacacctgaaacacttcttctca 54367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0020 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: scaffold0020
Description:

Target: scaffold0020; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 98738 - 98567
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||| ||||||| ||  ||| |||| || ||||| ||||||||||||||||| || |||||||| ||||||||||| ||||| | | |||||||||||    
T  98738 ggtttgtgtaccagtcagagcaaacaccttaccaccagtcctaaccttcttcggctgtgtgcactgcgaactgatatggccctc-ttcgttgcagttata 98640  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     ||||| | |||||||||||||||||||||||    ||| || ||||| |||||||||||||||||| |||||    
T  98639 acatacaacatcaccacgcttgcaatcagctagagtgtgtcctttctgaccacacctgaaacacttcttctca 98567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0020; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 166 - 243
Target Start/End: Original strand, 176230 - 176307
Alignment:
Q  166 ttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||| || | ||||||||||||||||||||||||   ||| || |||| ||||||||| ||||||||| |||||    
T  176230 ttatagcaaacaacatcaccacgcttgcaatcagctaatgtgtgtcctttctttccacacctaaaacacttcttctca 176307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 22054053 - 22054220
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| ||||| || ||| |||||||||| || |||||||| | ||||||||| ||||| ||  ||||||||||| |||    
T  22054053 tgcgtaccagtcaaagcaaacacttttccaccagttctatccttcttcggctgtgtgcactgtgtactgatatggccctcttcg-ttgcagttataacat 22054151  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||||||||||||| ||||| | |||||||||||| ||||| ||||| |||||| |||||    
T  22054152 acaacatcaccacgcttgcaatccgctaaaaggtgacccttctgaccacatctgaagcacttcttctca 22054220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 22027871 - 22027704
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||| | ||| ||| ||||||| |||||||| |||||||||||||| || |||||||||||||||||||| ||||| | ||||| ||||||||||     
T  22027871 tgcgtaccggtcaatgcaaacacttttccaccggttctaaccttcttcggctgtgtgcactgagaactgatatggccctc-ttcattgtagttatagcaa 22027773  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || |  || || | ||| |||||||||||   |||||||||||| ||||||||||| |||||| |||||    
T  22027772 acaacgtctcccctcttacaatcagctaatgtgtgacccttctgaccacacctgaagcacttcttctca 22027704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 16268815 - 16268648
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| ||||| || ||| |||||||||| | ||  ||||| ||||||||||||||||| ||||||||| || |||||     
T  16268815 tgcgtaccagtcaaagcaaacacttttccaccagttctagccttcttcggctcaggacactgtgaactgatatgaccctc-tccattgcaattgtagcag 16268717  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| ||||||||||| |||||||     ||||||||||| ||||||||||| |||||| |||||    
T  16268716 acaatatccccacgcttgcattcagctaggctatgacccttctgaccacacctgaagcacttcctctca 16268648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 94 - 202
Target Start/End: Complemental strand, 29300998 - 29300891
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    |||||||||||||| ||||| |||||||||| ||||| |||||||||||||||||||| || | |||||||||||||| | || || || |||||||| |    
T  29300998 acactttcccaccgatcctagccttcttcggctgagtacactgagaactgatatgaccttc-ttcattgcagttatagtagacaatgtccccacgcttac 29300900  T
Q  194 aatcagcta 202  Q
    | |||||||    
T  29300899 attcagcta 29300891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 79 - 243
Target Start/End: Complemental strand, 31414119 - 31413956
Alignment:
Q  79 taccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatacta 178  Q
    |||||| ||| ||| |||||||||||||||| ||| |||||||||  ||||| ||||| |||||||||||||| || | | |||||||| ||||| || |    
T  31414119 taccagtcaatgcaaacactttcccaccggttctagccttcttcgactgagtacactgtgaactgatatgaccttc-ttcgttgcagttgtagcaaacaa 31414021  T
Q  179 tatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | || |||||||| || |||||||    ||| || ||||| |||||||| ||||||||| |||||    
T  31414020 tgtccccacgcttacattcagctagtgtgtgtcctttctgaccacacctaaaacacttcctctca 31413956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 132 - 237
Target Start/End: Original strand, 28984158 - 28984262
Alignment:
Q  132 cactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaa 231  Q
    ||||| |||||||||||||| ||  ||||||||||| || || || || || ||||||||||| ||||||||   |||||||||||| |||||||||||     
T  28984158 cactgtgaactgatatgaccttcc-ccattgcagttgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaag 28984256  T
Q  232 cacttc 237  Q
    ||||||    
T  28984257 cacttc 28984262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 237
Target Start/End: Original strand, 22374149 - 22374220
Alignment:
Q  166 ttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    |||||||| || ||||||||||||||||||||||||||   ||| || |||| ||||||||| |||||||||    
T  22374149 ttatagcaaacaatatcaccacgcttgcaatcagctaatgtgtgtcctttctttccacacctaaaacacttc 22374220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 243
Target Start/End: Original strand, 21928708 - 21928785
Alignment:
Q  166 ttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||| || | ||||||||||||||||||| | ||   ||| || ||||||||||| |||||||||||| |||||    
T  21928708 ttatagcaaacgacatcaccacgcttgcaatcacccaaagtgtgtcctttctgtccacatctgaaacacttcttctca 21928785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 17266628 - 17266497
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| |||||||| || ||| || ||||||||||| | |||||| ||||||||||| |||| || ||||    
T  17266628 ctaaccttcttcggctgtgtgcactgagtactgatgtgaccctcttc-attacaattatagcatacaacatcaccgcgcttgcaatcggctagcatgtga 17266530  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||||||||| |||||| |||||    
T  17266529 cccttctgtccacacctgaagcacttcttctca 17266497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 23078235 - 23078068
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    ||||||| || ||| ||| |||||||||||||||||||| |||||||||| ||||| ||||  |||||||||||||| || | | |||||||| |||||     
T  23078235 tgcgtactagtcaatgcaaacactttcccaccggtcctagccttcttcggctgagtacactatgaactgatatgaccttc-ttcgttgcagttgtagcaa 23078137  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||| |||||||||||||| ||| |||||    
T  23078136 acaatgtctccacgcttacattcagctagggtgtgtcctttctgaccacacctgaaacatttcctctca 23078068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 25851110 - 25851271
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | || |||||||| || ||| |||||||||| | ||  ||||| ||||| ||||||||||| |||||||||||| |||||     
T  25851110 tgcgtaccagtcaaagcaaataccttcccaccagttctagccttcttcggctcaggacactgtgaactaatatgaccctc-tccattgcagttgtagcag 25851208  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||| | |||||||    |||||||||||| ||||||||||| ||||||    
T  25851209 acaatgtctccacgcttgtattcagctagactgtgacccttctgaccacacctgaagcacttc 25851271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 242
Target Start/End: Original strand, 22505717 - 22505883
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || || || || |||||||||||||||| ||  ||||| |||||||| |||||||| |||||||||||| |||||     
T  22505717 tgcgtaccagtcaatgcaaacaccttgcccccagttctaaccttcttcggttcaggacactgtgaactgatgtgaccctc-tccattgcagttgtagcag 22505815  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctc 242  Q
    || || || |||||||| || ||||||||    || ||| |||| ||||||||||| |||||| ||||    
T  22505816 acaatgtccccacgcttacattcagctaagctatgtcccatctgaccacacctgaagcacttcctctc 22505883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 23563501 - 23563331
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||| | ||| ||| |||| || ||||| ||||||||||||||||| || || ||||| ||||| |||||||| || | |||||||||||||     
T  23563501 gtttgcgtaccggtcaaagcaaacaccttaccaccagtcctaaccttcttcggctgcgtacactgcgaactaatatgaccttcct-cattgcagttataa 23563403  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||  | || |||| ||| || |||||||    ||| || ||||| ||||||||||| |||||| |||||    
T  23563402 caaacattgtctccacccttacagtcagctagtgtgtgtcctttctgaccacacctgaagcacttcttctca 23563331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 14884321 - 14884160
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||  | |||  |||| |||| | ||  ||||| ||||| |||||||| ||  ||||||||||| || ||     
T  14884321 tgcgtaccagtcaaagcaaacactttcccaccaattctagtcttcctcggctcaggacactgtgaactaatatgaccttcc-ccattgcagttgtaacag 14884223  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||| ||   |||||||||||| ||||||||||| ||||||    
T  14884222 acaatgtccccacgcttgcattcagccaaactgtgacccttctgaccacacctgaagcacttc 14884160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 237
Target Start/End: Original strand, 20345344 - 20345481
Alignment:
Q  99 ttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatca 198  Q
    |||||||| || ||| |||||||||| | ||  ||||| ||||| |||||||| ||  ||||||||||| ||||| || || || ||||||||||| |||    
T  20345344 ttcccaccagttctagccttcttcggctcaggacactgtgaactaatatgaccttcc-ccattgcagttgtagcagacaatgtccccacgcttgcattca 20345442  T
Q  199 gctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
     |||    |||||||||||| ||||||||||| ||||||    
T  20345443 actagactgtgacccttctgaccacacctgaagcacttc 20345481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 20824491 - 20824658
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | ||||| || || ||||| |||||||| ||||| |||||||| ||||| || ||||| ||||| |   |||||| | ||     
T  20824491 tgcgtaccagtcaaagcaaatacttttcctccagtcctgaccttcttaggttgcgtgcactgcgaactaatgtgaccttcatc-accacagttaaaacaa 20824589  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| ||||||||||| ||  | ||||| ||||| ||||| || || |||||||| ||| |||||    
T  20824590 acaatatctccacgcttgcagtccaccaacacatgacctttctgaccgcatctgaaacatttcttctca 20824658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0765 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: scaffold0765
Description:

Target: scaffold0765; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 102 - 243
Target Start/End: Complemental strand, 6381 - 6241
Alignment:
Q  102 ccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagct 201  Q
    ||||| || |||||||||||| |||| |||||||||| |||||| || |||| || | || || ||||||||||| ||||| |||||||| |||||||||    
T  6381 ccaccagttctaaccttcttctgttgtgtgcactgagtactgatgtggccct-attcgttacaattatagcatacaatatcgccacgcttacaatcagct 6283  T
Q  202 aacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | ||||||||||||||| ||||||||||| |||||| |||||    
T  6282 agcacgtgacccttctgaccacacctgaagcacttcttctca 6241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 74 - 243
Target Start/End: Complemental strand, 2104 - 1936
Alignment:
Q  74 ttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagca 173  Q
    ||||||||||| ||  ||| ||||||| |||||||||||||||||||||||||| || ||||| |||||||||||||| || | ||||||||||||||||    
T  2104 ttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgtgtacactgcgaactgatatgaccttcct-cattgcagttatagca 2006  T
Q  174 tactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || |  || || ||||| |||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  2005 aacaacgtctccccgcttacaatcagctaatgtgtgtcctttctgaccacacctgaagcacttcttctca 1936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 114 - 243
Target Start/End: Original strand, 70564 - 70692
Alignment:
Q  114 accttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgaccc 213  Q
    |||||||| ||||| |||||||| ||||| || || ||||| || ||| |||||||| || || ||||| ||||||||||| ||||| ||||| |||||     
T  70564 accttcttaggttgcgtgcactgtgaactaatgtggccctcctc-attacagttataacaaacaatatctccacgcttgcattcagccaacacatgacct 70662  T
Q  214 ttctgtccacacctgaaacacttcatctca 243  Q
    || || || || |||||||||||| |||||    
T  70663 ttatgaccgcatctgaaacacttcttctca 70692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0310 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0310
Description:

Target: scaffold0310; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 11130 - 11297
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| ||||| ||||||||| |||||||||| ||||| ||||| || |||||||||||||| | |||||||||| |||||     
T  11130 tgcgtaccagtcaacgcaaacaccttccctccggtcctagccttcttcggctgagtacactgtgagctgatatgaccctc-ttcattgcagttgtagcag 11228  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||   |||| |||||||| ||||||||||| |||||| |||||    
T  11229 acaatgtccccacgcttacattcagctagtgcgtgtcccttctgaccacacctgaagcacttcctctca 11297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0239 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0239
Description:

Target: scaffold0239; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 9938 - 9771
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| ||||| || ||||||||||||||  | |||||||| | ||||||||| | ||| ||  ||||||||||| |||    
T  9938 tgcgtaccagtcaaagcaaacacttttccaccagttctaaccttcttcggcagtgtgcactgtgtactgatatggcactcttcg-ttgcagttataacat 9840  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||||||||||||| ||||| | |||||||||||  ||||||||||| |||||| |||||    
T  9839 acaacatcaccacgcttgcaatccgctaaaaggtgacccttctaaccacacctgaagcacttcttctca 9771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 61; Significance: 3e-26; HSPs: 4)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 49331 - 49164
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||||||| ||| ||||||||| ||| || ||||||||||||||||| |||||||| ||||| ||||| ||||| | |||  || ||||||||     
T  49331 tgcgtaccagccaaagcaaacactttcctaccagttctaaccttcttcggttgtgtgcactgtgaactaatatggccctc-ttcatcacaattatagcaa 49233  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||| ||||||||||||||||| |||||    ||| || ||||| |||||||||||||| ||| |||||    
T  49232 actacatcaccacgcttgcaattagctagtgtgtgtcctttctgaccacacctgaaacatttcttctca 49164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 58365 - 58198
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||||||| ||| ||||||||| ||| || ||||||||||||||||| |||||||| ||||| ||||| ||||| | |||  || ||||||||     
T  58365 tgcgtaccagccaaagcaaacactttcctaccagttctaaccttcttcggttgtgtgcactgtgaactaatatggccctc-ttcatcacaattatagcaa 58267  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||| ||||||||||||||||| |||||    ||| || ||||| |||||||||||||| ||| |||||    
T  58266 actacatcaccacgcttgcaattagctagtgtgtgtcctttctgaccacacctgaaacatttcttctca 58198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 64753 - 64586
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||||||| ||| ||||||||| ||| || ||||||||||||||||| |||||||| ||||| ||||| ||||| | |||  || ||||||||     
T  64753 tgcgtaccagccaaagcaaacactttcctaccagttctaaccttcttcggttgtgtgcactgtgaactaatatggccctc-ttcatcacaattatagcaa 64655  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||| ||||||||||||||||| |||||    ||| || ||||| |||||||||||||| ||| |||||    
T  64654 actacatcaccacgcttgcaattagctagtgtgtgtcctttctgaccacacctgaaacatttcttctca 64586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 29777 - 29944
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| |||||||||||||||||||| || ||||| |||||||||||||| || | |||||||  |||| ||     
T  29777 tgcgtaccagtcaaagcaaacaccttaccacctgtcctaaccttcttcggttgcgtacactgcgaactgatatgaccttcct-cattgcaaatataacaa 29875  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||| ||| ||||||||||    ||| ||||| || ||||||||||| |||||| |||||    
T  29876 acgatgtccccacacttacaatcagctagagtgtgtcccttttgaccacacctgaagcacttcttctca 29944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 14)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 53750582 - 53750451
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| || ||||| || ||| || ||||||||||| | |||||| ||||||||||| |||| || ||||    
T  53750582 ctaaccttcttcggctgtgtgcactgagtactgatgtggccctcttc-attacaattatagcatacaacatcaccgcgcttgcaatcggctagcatgtga 53750484  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  53750483 cccttctgtccacatctgaaacacttcttctca 53750451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 20893155 - 20893322
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| || |||||||||||||| | ||| ||||| ||||||||||| ||||| || ||||||||| ||| |     
T  20893155 tgcgtaccagtcaaagcaaacacctttccaccagttctaaccttcttcggctcagtacactgcgaactgatatgcccctcttc-attgcagttgtagtag 20893253  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| ||||||||||| ||||||||   ||| |||||||| ||||||||||| |||||| |||||    
T  20893254 acaatatccccacgcttgcattcagctaaattgtgtcccttctgaccacacctgaagcacttcctctca 20893322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 51603904 - 51603773
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| || |||||||||| |||||| || ||||| || ||| || |||||||| || | |||||| ||||||||||| |||| || ||||    
T  51603904 ctaaccttcttcggctgtgtgcactgagtactgatgtggccctcttc-attacaattatagcacacaacatcaccgcgcttgcaatcggctagcatgtga 51603806  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||| |||||||||||| |||||    
T  51603805 cccttctgtccacatctgaaacacttcttctca 51603773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 78 - 243
Target Start/End: Original strand, 7357394 - 7357558
Alignment:
Q  78 gtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatact 177  Q
    ||||||| ||| ||| |||| |||||||  || ||| |||||||||| | ||  ||||| ||||| ||||||||||| |||||||||||| ||||| ||     
T  7357394 gtaccagtcaatgcaaacaccttcccactagttctagccttcttcggctcaggacactgtgaactaatatgaccctc-tccattgcagttgtagcagaca 7357492  T
Q  178 atatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||||||||| ||||||||   |||||||||||| ||||||||||| |||||| |||||    
T  7357493 atgtctccacgcttgcattcagctaaattgtgacccttctgaccacacctgaagcacttcctctca 7357558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 237
Target Start/End: Complemental strand, 14993518 - 14993354
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||  ||| ||| |||| || ||||| |||||||||||||| ||||| || ||||| |||||||||||||| || | |||||||||| |||    
T  14993518 gtttgcgtaccattcaaagcaaacaccttgccacctgtcctaaccttcttaggttgcgtacactgcgaactgatatgaccttcct-cattgcagttgtag 14993420  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || | ||| ||| ||||||||||||||||   ||| || ||||| ||||||||||| ||||||    
T  14993419 caaacaacatccccatgcttgcaatcagctaaagtgtgtcctttctgaccacacctgaagcacttc 14993354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 77 - 243
Target Start/End: Original strand, 16150762 - 16150927
Alignment:
Q  77 cgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatac 176  Q
    |||||||| ||| ||| |||||||||||||||| ||||||||||||||||   |||| || || || ||||| ||||| | |||  ||||||||||| ||    
T  16150762 cgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggtttcttgcattgcgagctaatatgcccctc-ttcatcacagttatagcaaac 16150860  T
Q  177 tatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     | |||||||||||||||||||||||    ||| || ||||| ||||||||||| |||||| |||||    
T  16150861 aacatcaccacgcttgcaatcagctagtgtgtgtcctttctgaccacacctgaagcacttcttctca 16150927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 77 - 243
Target Start/End: Original strand, 16154908 - 16155073
Alignment:
Q  77 cgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatac 176  Q
    |||||||| ||| ||| |||||||||||||||| ||||||||||||||||   |||| || || || ||||| ||||| | |||  ||||||||||| ||    
T  16154908 cgtaccagtcaatgcaaacactttcccaccggttctaaccttcttcggtttcttgcattgcgagctaatatgcccctc-ttcatcacagttatagcaaac 16155006  T
Q  177 tatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     | |||||||||||||||||||||||    ||| || ||||| ||||||||||| |||||| |||||    
T  16155007 aacatcaccacgcttgcaatcagctagtgtgtgtcctttctgaccacacctgaagcacttcttctca 16155073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 230
Target Start/End: Complemental strand, 11204380 - 11204226
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| |||||||| || ||| |||| ||||| | ||  ||||| ||||||||||||||||| ||||||||| || |||||     
T  11204380 tgcgtaccagtcaaagcaaacaccttcccaccagttctagcctttttcggctcaggacactgtgaactgatatgaccctc-tccattgcaattgtagcag 11204282  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaa 230  Q
    || ||||| ||||||||||| | |||||    |||||||||||| |||||||||||    
T  11204281 acaatatccccacgcttgcattaagctagactgtgacccttctgaccacacctgaa 11204226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 102 - 243
Target Start/End: Original strand, 15266927 - 15267067
Alignment:
Q  102 ccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagct 201  Q
    ||||||||||||||||||||||| || || ||||  |||||||||||||| || | | |||||||||||||| || || || ||| |||| |||||||||    
T  15266927 ccaccggtcctaaccttcttcggctgcgtacactacgaactgatatgaccttc-ttcgttgcagttatagcaaacaatgtctccatgcttacaatcagct 15267025  T
Q  202 aacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |    ||| || ||||| ||||||||||| |||||| |||||    
T  15267026 agagtgtgtcctttctgaccacacctgaagcacttcttctca 15267067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 114 - 243
Target Start/End: Original strand, 27903548 - 27903676
Alignment:
Q  114 accttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgaccc 213  Q
    |||||||| ||||| |||||||| ||||| || |  ||||| || ||| |||||||| || || ||||| ||||||||||| ||||| ||||| |||||     
T  27903548 accttcttaggttgcgtgcactgtgaactaatgttgccctcctc-attacagttataacaaacaatatctccacgcttgcattcagccaacacatgacct 27903646  T
Q  214 ttctgtccacacctgaaacacttcatctca 243  Q
    ||||| ||||| |||||||||||| |||||    
T  27903647 ttctgaccacatctgaaacacttcttctca 27903676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 3261942 - 3261781
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  3261942 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 3261844  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  3261843 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 3261781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 44659014 - 44658853
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||  ||| ||| |||| || ||||| || |||  ||||||||||| ||  ||||| ||||| |||||||  || ||||||||| || || ||     
T  44659014 tgcgtaccattcaaagcaaacacctttccaccagttctagtcttcttcggttcaggacactgtgaactaatatgacattc-tccattgcaattgtaacag 44658916  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || ||||| ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  44658915 acaatatccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 44658853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 132 - 237
Target Start/End: Complemental strand, 29450628 - 29450524
Alignment:
Q  132 cactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaa 231  Q
    ||||| |||||||| ||||| ||  ||||||||||| || || || || || ||||||||||| ||||||||   |||||||||||| ||||||||||||    
T  29450628 cactgtgaactgatgtgaccttcc-ccattgcagttgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaaa 29450530  T
Q  232 cacttc 237  Q
    ||||||    
T  29450529 cacttc 29450524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 243
Target Start/End: Original strand, 18259629 - 18259732
Alignment:
Q  139 aactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttca 238  Q
    ||||||||||||| || || ||||||||||||||| || || || |||||||| ||||||||||    ||| || ||||| ||||||||||| ||||||     
T  18259629 aactgatatgaccttcctc-attgcagttatagcaaacaatgtccccacgcttacaatcagctagagtgtgtcctttctgaccacacctgaagcacttct 18259727  T
Q  239 tctca 243  Q
    |||||    
T  18259728 tctca 18259732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 13)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 21961197 - 21961364
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | || || ||||| || |||||||||||||| | || |||||| ||||||||||||||||| |||||||||||| |||||     
T  21961197 tgcgtaccagtcaaagcaaatacctttccaccagttctaaccttcttcggctcagggcactgcgaactgatatgaccctc-tccattgcagttgtagcag 21961295  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| |||||||| || ||||||||   ||| |||||||| ||||||||||| |||||| |||||    
T  21961296 acaatatccccacgcttacattcagctaaactgtgtcccttctgaccacacctgaagcacttcctctca 21961364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 52988911 - 52989078
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || || || || |||||||||||||||| ||  || || ||||||||||||||||| |||||||||||| |||||     
T  52988911 tgcgtaccagtcaatgcaaacaccttgcccccagttctaaccttcttcggttcaggacattgtgaactgatatgaccctc-tccattgcagttgtagcag 52989009  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || ||||||||   |||||||||||| |||||||||||||||||| |||||    
T  52989010 acaatgtccccacgcttacattcagctaaattgtgacccttctgaccacacctgaaacacttcctctca 52989078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 111 - 243
Target Start/End: Complemental strand, 20074893 - 20074762
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| | ||  ||||| ||| ||||||||||||| |||||||||||| ||||| || ||||| ||||||||||| ||||| ||   ||||    
T  20074893 ctaaccttcttcggctcaggacactgcgaattgatatgaccctc-tccattgcagttgtagcagacaatatccccacgcttgcattcagccaagctgtga 20074795  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||| ||||||||||| |||||| |||||    
T  20074794 cccttctgaccacacctgaagcacttcctctca 20074762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 24096835 - 24096668
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||| ||| |||||||||| ||||| ||||| |||||||||||||| || | | |||||||| |||||     
T  24096835 tgcgtaccagtcaatgcaaacactttcccaccggttctagccttcttcggctgagtacactgtgaactgatatgaccttc-ttcgttgcagttgtagcaa 24096737  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||| |||||||| ||||||||| |||||    
T  24096736 acaatgtccccacgcttacattcagctagtgtgtgtcctttctgaccacacctaaaacacttcctctca 24096668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 20833124 - 20832953
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| | |||||||||||||||| ||||||| || ||||| |||||||| ||||| || | |||||||||||||    
T  20833124 ggtttgcgtaccagtcagagcaaacactttactaccggtcctaaccttcctcggttgcgtacactgcgaactgatgtgaccttcct-cattgcagttata 20833026  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | ||| || | ||||||||||||||    ||| || ||||| |||||||||||||| ||| |||||    
T  20833025 acaaacaacatctcccctcttgcaatcagctagtgtgtgtcctttctgaccacacctgaaacaattcttctca 20832953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 22015968 - 22015798
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| ||||||||||||||||| || || |||||  |||| |||||| | || ||  |||||||||||     
T  22015968 gtttgcgtaccagtcaaagcaaacaccttgccacctgtcctaaccttcttcggctgcgtacactgcaaactaatatgatcttcctcg-ttgcagttataa 22015870  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| ||||||||||||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  22015869 caaacaacatccccacgcttgcaatcagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 22015798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 19857440 - 19857611
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||| |||| ||||||||||||||||||| ||||| ||||| |||||||| || | ||||| |||||||    
T  19857440 ggtttgcgtaccagtcagagcaaacactttaccactggtcataaccttcttcggttgagtacactgcgaactaatatgaccttcct-cattgtagttata 19857538  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || || || || ||||| ||||||||||    ||| || ||||| ||||||||||| || ||| |||||    
T  19857539 acaaacaatgtctccccgcttacaatcagctagtgtgtgtcctttctgaccacacctgaagcatttcttctca 19857611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 38910046 - 38909885
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||||||| | || || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  38910046 tgcgtaccagtcaaggcaaaaacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 38909948  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  38909947 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 38909885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 48426043 - 48426204
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || |||||  | |||  ||||||||| | ||  ||||| |||||||||||||| ||  ||||||||||| || ||     
T  48426043 tgcgtaccagtcaaagcaaacacctttccaccaattctagtcttcttcggctcaggacactgtgaactgatatgaccttcc-ccattgcagttgtaacag 48426141  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  48426142 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 48426204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 94 - 243
Target Start/End: Original strand, 20297572 - 20297720
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    |||| |||||||| || |||||||||||||  | ||  ||||  ||||| |||||||| || |||||||||||| ||||| || || || ||||||||||    
T  20297572 acaccttcccaccagttctaaccttcttcgactcaggacactatgaactaatatgaccttc-tccattgcagttgtagcagacaatgtccccacgcttgc 20297670  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | |||||||    |||||||||||  ||||||||||| |||||| |||||    
T  20297671 attcagctaggctgtgacccttctaaccacacctgaagcacttcctctca 20297720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 21742775 - 21742605
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | || || ||||| |||||||||||||| || || || ||||| ||||| ||||| || || | |||| ||||| |||    
T  21742775 gtttgcgtaccagtcaacgcaaataccttgccacctgtcctaaccttcttaggctgcgtacactgcgaactaatatgtccttcct-cattacagttgtag 21742677  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| ||||||||||||||||| ||   ||| || ||||| |||||||| || |||||| |||||    
T  21742676 caaacaacatccccacgcttgcaatcagccaatgtgtgtcctttctgaccacacctaaagcacttcttctca 21742605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 37680219 - 37680380
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| ||||||||  | |||  |||| |||| | ||  ||||| ||||| |||||||| || ||||||||| || || ||     
T  37680219 tgcgtaccagtcaaagcaaacaccttcccaccaattctagtcttcctcggctcaggacactgtgaactaatatgaccttc-tccattgcaattgtaacag 37680317  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  37680318 acaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 37680380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 31537136 - 31537063
Alignment:
Q  157 ccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaa 230  Q
    ||||||||||| || || || || || ||||||||||| ||||||||   |||||||||||| |||||||||||    
T  31537136 ccattgcagttgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaa 31537063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0108 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0108
Description:

Target: scaffold0108; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 50255 - 50425
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| |||||||||||||| || || || ||||  |||||||||||||| || || ||||||||| |||    
T  50255 gtttgcgtaccagtcaaagcaaacaccttgccacctgtcctaaccttcttaggctgggtacactacgaactgatatgaccttcctc-attgcagttgtag 50353  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| |||||||| |||||||||||   ||| || ||||| |||||||||||||||||| |||||    
T  50354 caaacaatatccccacgcttacaatcagctaaggtgtgtcctttctgaccacacctgaaacacttcttctca 50425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1426 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold1426
Description:

Target: scaffold1426; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 1758 - 1591
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| || || || ||||||||||||||||  |  ||||| ||||||||||||||||| |||||||||||| |||||     
T  1758 tgcgtaccagtcaatgcaaacactttgcccccagttctaaccttcttcggttcgggacactgtgaactgatatgaccctc-tccattgcagttgtagcag 1660  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |  || || ||||||||||| ||||||||   ||| |||||||| ||||||||||| |||||| |||||    
T  1659 ataatgtccccacgcttgcattcagctaaactgtgtcccttctgaccacacctgaagcacttcctctca 1591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0706 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0706
Description:

Target: scaffold0706; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 5364 - 5193
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||| ||||||||||||||||  || ||||  ||||||||||| ||||| | |||||||||||||    
T  5364 ggtttgcgtaccagtcagagcaaacactttaccaccggttctaaccttcttcggttatgtacactatgaactgatatggccctcct-cattgcagttata 5266  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || | ||| |  ||||| |||||||||||   ||| |||||||| ||||||||||| |||||| |||||    
T  5265 gcaaacaacatctctccgcttacaatcagctaaagtgtgtcccttctgaccacacctgaagcacttcttctca 5193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 5202 - 5373
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||| || | |||||||||||||    
T  5202 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgagtacactgcgaactgatatgaccttcct-cattgcagttata 5300  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || |  || || ||||| |||| ||||||   ||| || ||||  ||||||||||| |||||| |||||    
T  5301 acaaacaacgtctccccgcttacaattagctaatgtgtgtcctttctaaccacacctgaagcacttcttctca 5373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0139 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0139
Description:

Target: scaffold0139; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 175
Target Start/End: Complemental strand, 19124 - 19021
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||||||||| || ||||| |||||||||||||| || | |||||||||||||    
T  19124 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgtgtacactgcgaactgatatgaccttcct-cattgcagttata 19026  T
Q  171 gcata 175  Q
    |||||    
T  19025 gcata 19021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0058 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0058
Description:

Target: scaffold0058; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 78 - 198
Target Start/End: Original strand, 22278 - 22397
Alignment:
Q  78 gtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatact 177  Q
    ||||||| ||| ||| ||||| | ||| |||| |||||||||||||| || |||||||||||||||||||| ||||| | |||||||||||||||| ||     
T  22278 gtaccagtcaatgcaaacactataccaacggttctaaccttcttcggctgtgtgcactgagaactgatatggccctc-ttcattgcagttatagcaaaca 22376  T
Q  178 atatcaccacgcttgcaatca 198  Q
    | |||||||||||||||||||    
T  22377 acatcaccacgcttgcaatca 22397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 39488 - 39317
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||||| ||| || ||||| ||||||||| |||| || | |||||||||||||    
T  39488 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcgattgtgtacactgcgaactgatacgaccttcct-cattgcagttata 39390  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || | ||| || ||||| |||| ||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  39389 gcaaacaacatctccccgcttacaattagctaatgtgtgtcctttctgaccacacctgaagcacttcttctca 39317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 114 - 243
Target Start/End: Complemental strand, 180951 - 180823
Alignment:
Q  114 accttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgaccc 213  Q
    |||||||| |||||||||||||| ||||| || ||||||||||| |   |||||| | || || ||||| ||||||||||||||||| ||||| ||||||    
T  180951 accttcttaggttgagtgcactgcgaactaatgtgaccctcatc-accacagttaaaacaaacaatatctccacgcttgcaatcagccaacacatgaccc 180853  T
Q  214 ttctgtccacacctgaaacacttcatctca 243  Q
    ||||| || || |||||||| ||| |||||    
T  180852 ttctgaccgcatctgaaacatttcttctca 180823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 325856 - 326027
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||| ||| ||||||| |||||||| ||||||||||| ||||| |||||||| ||||||||||| ||||| | |||||||||||||    
T  325856 ggtttgcgtaccagtcaaagcaaacactttaccaccggttctaaccttctttggttgtgtgcactgtgaactgatatggccctc-ttcattgcagttata 325954  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     || || | ||| || ||||| |||| ||||||   ||| || ||||| |||||| |||| |||||| |||||    
T  325955 acaaacaacatctccccgcttacaattagctaatgtgtgtcctttctgaccacacttgaagcacttcttctca 326027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0156 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0156
Description:

Target: scaffold0156; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 37089 - 37259
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||| | ||| | | |||| || ||||| ||||||||||||||||| || || ||||| |||||||||||||| || | ||||||||||||||    
T  37089 gtttgcgtaccggtcaaagaaaacaccttaccaccagtcctaaccttcttcggctgcgtacactgtgaactgatatgaccttcct-cattgcagttatag 37187  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| |||| ||| ||||||||||    ||| |||||||| ||||||||||| |||||| |||||    
T  37188 caaacaatatccccacacttacaatcagctagtgtgtgtcccttctgaccacacctgaagcacttcttctca 37259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0023 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0023
Description:

Target: scaffold0023; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 77 - 243
Target Start/End: Complemental strand, 164550 - 164385
Alignment:
Q  77 cgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatac 176  Q
    |||||| | ||| ||| |||||||||||||||| |||||||||||||| |||||  | || ||||||||||| || || || |||||||||||| || ||    
T  164550 cgtaccggtcaatgcaaacactttcccaccggttctaaccttcttcggctgagtataatgcgaactgatatggccttcttc-attgcagttataacaaac 164452  T
Q  177 tatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     | || |||||||||||||||| ||||   ||| || ||||| |||||||||||||||||| |||||    
T  164451 aacattaccacgcttgcaatcaactaaagtgtgtcctttctgaccacacctgaaacacttcttctca 164385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0708 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0708
Description:

Target: scaffold0708; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 5296 - 5129
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||||||| |||||||||| ||||| ||||  |||||||||||||| || | | |||||||| |||||     
T  5296 tgcgtaccagtcaatgcaaacactttcccaccggtcctagccttcttcggctgagtacactatgaactgatatgaccttc-ttcgttgcagttgtagcag 5198  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||| |||||||||||||| ||| |||||    
T  5197 acaatgtctccacgcttacattcagctagggtgtgtcctttctgaccacacctgaaacatttcctctca 5129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0118
Description:

Target: scaffold0118; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 614 - 781
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || || || || |||||||||||||||| ||  ||||| ||||| ||||||||||| |||||||||||| |||||     
T  614 tgcgtaccagtcaatgcaaacaccttgcccccagttctaaccttcttcggttcaggacactgtgaacttatatgaccctc-tccattgcagttgtagcag 712  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || ||||||||   |||||||||||| || |||||||| |||||| |||||    
T  713 acaatgtccccacgcttacattcagctaaattgtgacccttctgaccgcacctgaagcacttcctctca 781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 263379 - 263546
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| ||||  || |||||||||||||  || |||||||| | ||||||||| ||||| ||  || |||||||| |||    
T  263379 tgcgtaccagtcaaagcaaacacttttccactagttctaaccttcttcgactgtgtgcactgtgtactgatatggccctcttcg-ttacagttataacat 263477  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||  ||||||||| ||||| | |||||||||||| ||||||||||| |||||| |||||    
T  263478 acaacatcaccatccttgcaatccgctaaaaggtgacccttctgaccacacctgaagcacttcttctca 263546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 203534 - 203701
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| ||||||| ||||  || |||||||||||||  || |||||||| | ||||||||| ||||| ||  || |||||||| |||    
T  203534 tgcgtaccagtcaaagcaaacacttttccactagttctaaccttcttcgactgtgtgcactgtgtactgatatggccctcttcg-ttacagttataacat 203632  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || | |||||||  ||||||||| ||||| | |||||||||||| ||||||||||| |||||| |||||    
T  203633 acaacatcaccatccttgcaatccgctaaaaggtgacccttctgaccacacctgaagcacttcttctca 203701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0523 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: scaffold0523
Description:

Target: scaffold0523; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 5590 - 5760
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| ||||||| ||||| |||||||||||||| ||||| || ||||| |||||||||||||| || | |||| || || |||    
T  5590 gtttgcgtaccagtcaacgcaaacactttgccacctgtcctaaccttcttaggttgcgtacactgcgaactgatatgaccttc-ttcattacaattgtag 5688  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| |||||||| |||||||||||   ||| || ||||| |||||||| || |||||| |||||    
T  5689 caaacaacatccccacgcttacaatcagctaaagtgtgtcctttctgaccacacctaaagcacttcttctca 5760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0523; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 237
Target Start/End: Complemental strand, 11897 - 11733
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| |||||||| || |||  ||||||||||| ||  ||||| | ||| |||||||| || |||||||||||| ||     
T  11897 gtttgcgtaccagtcaaagcaaacaccttcccaccagttctagtcttcttcggttcaggacactgtgtactaatatgaccttc-tccattgcagttgtaa 11799  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    || || || || ||||||||||  ||||||||   |||||||||||| ||||||||||| ||||||    
T  11798 cagacaatgtccccacgcttgctttcagctaaactgtgacccttctgaccacacctgaagcacttc 11733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold0046
Description:

Target: scaffold0046; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 70258 - 70428
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| |||||||||||||| || || || ||||| ||||| ||||| || || || ||| ||||| |||    
T  70258 gtttgcgtaccagtcaaagcaaacaccttgccacctgtcctaaccttcttaggctgcgtacactgcgaactaatatgtccttcctc-attacagttgtag 70356  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| ||||||||||||||||| ||   ||| || ||||||||||| |||||||||||| |||||    
T  70357 caaacaatatccccacgcttgcaatcagccaatgtgtgtcctttctgtccacatctgaaacacttcttctca 70428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0146 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0146
Description:

Target: scaffold0146; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 202
Target Start/End: Complemental strand, 438 - 309
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || |||||||||||||||||||||||||| || || || ||||| |||||||| || | |||||||||||||     
T  438 gtttgcgtaccagtcaaagcaaacaccttgccaccggtcctaaccttcttcggttgcgtacattgcgaactaatatgaccttcct-cattgcagttataa 340  T
Q  172 catactatatcaccacgcttgcaatcagcta 202  Q
    || || || || |||||||| ||||||||||    
T  339 caaacaatgtccccacgcttacaatcagcta 309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0367 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0367
Description:

Target: scaffold0367; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 9176 - 9005
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| |||| || |||||||||||||||||||||| ||| || ||||| ||| |||| ||||| || | |||||||||||||    
T  9176 ggtttgcgtaccagtcagagcaaacacattaccaccggtcctaaccttcttcgtttgtgtacactgcgaattgatttgaccttcct-cattgcagttata 9078  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || | ||| || ||||| |||| ||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  9077 gcaaacaacatctccccgcttacaattagctaatgtgtgtcctttctgaccacacctgaagcacttcttctca 9005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0076
Description:

Target: scaffold0076; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 53574 - 53407
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| | |||||||||||||| |||||||||||||| |  ||||| || ||||||||||| ||||| | |||| |||||||| |||    
T  53574 tgcgtaccagtcaatgcaaatactttcccaccggttctaaccttcttcggctatgtgcattgtgaactgatatggccctc-ttcattacagttataacat 53476  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || |  |||||||||||||||||| |||  | ||| || || || ||||||||||| || ||| |||||    
T  53475 accacgtcaccacgcttgcaatcaactaggatgtgtcctttttgaccacacctgaatcatttcttctca 53407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1517 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold1517
Description:

Target: scaffold1517; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 1638 - 1512
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||| |||||||| ||||||||||| ||||| ||||| |||||||||||||| || | |||||||||| |||||     
T  1638 tgcgtaccagtcaatgcaaacactttccctccggtcctgaccttcttcggctgagtacactgcgaactgatatgaccttc-ttcattgcagttgtagcaa 1540  T
Q  175 actatatcaccacgcttgcaatcagcta 202  Q
    || || || |||| ||| || |||||||    
T  1539 acaatgtccccacacttacattcagcta 1512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 1037 - 867
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||| | ||| ||| |||| || ||||| |||||||||||||||||||| || ||||| |||||||||||||| || | |||||||||||||     
T  1037 gtttgcgtaccggtcaaagcaaacaccttaccaccagtcctaaccttcttcggttgcgtacactgcgaactgatatgaccttcct-cattgcagttataa 939  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
     | || || || |||||||| ||||||||||    ||  || ||||| ||||||||||| |||||| |||||    
T  938 taaacaatgtccccacgcttacaatcagctagagtgtatcctttctgaccacacctgaagcacttcttctca 867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 63673 - 63503
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||  |||||||||||||| || || || ||||| |||||||||||||| || | ||||  |||| |||    
T  63673 gtttgcgtaccagtcaaagcaaacaccttgccacttgtcctaaccttcttaggctgcgtacactgcgaactgatatgaccttcct-cattatagttgtag 63575  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| ||| |||| |||||||||||   ||| || ||||| |||||||||||||||||| |||||    
T  63574 caaacaatatccccatgcttacaatcagctaaagtgtgtcctttctgaccacacctgaaacacttcttctca 63503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 242
Target Start/End: Complemental strand, 514504 - 514338
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || || || || |||||||||||||||| ||  ||||| ||||||||||||||||| |||||||||||| |||||     
T  514504 tgcgtaccagtcaatgcaaacaccttgcccccagttctaaccttcttcggttcaggacactgtgaactgatatgaccctc-tccattgcagttgtagcag 514406  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctc 242  Q
    || || || |||| ||| || |||| |||   ||| |||||||| ||||||||||| |||||| ||||    
T  514405 acaatgtccccacacttacattcagttaagctgtgtcccttctgaccacacctgaagcacttcctctc 514338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1433 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold1433
Description:

Target: scaffold1433; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 94 - 243
Target Start/End: Complemental strand, 1443 - 1295
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    ||||||| ||||| |||||||||||||| || ||||| ||||| |||||||||||||| || | |||||||  | ||||| || ||||| |||||||| |    
T  1443 acactttaccacctgtcctaaccttcttaggctgagtacactgcgaactgatatgaccttcct-cattgcaagtgtagcaaacaatatccccacgcttac 1345  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | ||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  1344 attcagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 1295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0404
Description:

Target: scaffold0404; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 94 - 243
Target Start/End: Original strand, 7916 - 8064
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    ||||||| ||||| |||||||||||||| || ||||| ||||| |||||||||||||| || | |||||||  | ||||| || ||||| |||||||| |    
T  7916 acactttaccacctgtcctaaccttcttaggctgagtacactgcgaactgatatgaccttcct-cattgcaagtgtagcaaacaatatccccacgcttac 8014  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | ||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  8015 attcagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 8064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0190 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0190
Description:

Target: scaffold0190; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 75 - 176
Target Start/End: Complemental strand, 30477 - 30377
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||||||||||||||||||| |||||||||| ||||| ||||  |||||||||||||| || | | |||||||| ||||||    
T  30477 tgcgtaccagtcaatgcaaacactttcccaccggtcctagccttcttcggctgagtacacttcgaactgatatgaccttc-ttctttgcagttgtagcat 30379  T
Q  175 ac 176  Q
    ||    
T  30378 ac 30377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0035 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0035
Description:

Target: scaffold0035; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 94 - 243
Target Start/End: Original strand, 5977 - 6125
Alignment:
Q  94 acactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgc 193  Q
    ||||||| |||||||||||||||||||||||||| || ||||| ||||| ||||| || || | | ||||||||||| || || || || ||||||||||    
T  5977 acactttaccaccggtcctaaccttcttcggttgtgtacactgtgaactaatatgtccttcct-cgttgcagttataacaaacaatgtccccacgcttgc 6075  T
Q  194 aatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||    ||| || ||||| ||||| ||||| |||||| |||||    
T  6076 aatcagctagtgtgtgtcctttctgaccacatctgaagcacttcttctca 6125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0243
Description:

Target: scaffold0243; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 9927 - 9756
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttata 170  Q
    |||||||||||||| ||  ||| |||| || ||||| |||||||||||||||||||| || || || ||||| ||||| ||||| | |||||||||||||    
T  9927 ggtttgcgtaccagtcagagcaaacaccttaccaccagtcctaaccttcttcggttgcgtacattgtgaacttatatggccctcct-cattgcagttata 9829  T
Q  171 gcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||| || | ||| || ||||| |||||| |||    ||| || ||||| ||||||||||| |||||| |||||    
T  9828 gcaaacaacatctccccgcttacaatcaactagggtgtgtcctttctgaccacacctgaagcacttcttctca 9756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold2165 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold2165
Description:

Target: scaffold2165; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 111 - 242
Target Start/End: Complemental strand, 918 - 788
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||||| ||  ||||| ||||| ||||||||||| |||||| ||||||||||| || || || |||||||| || ||||||||   |||     
T  918 ctaaccttcttcggttcaggacactgcgaactaatatgaccctc-tccatttcagttatagcagacaatgtccccacgcttacattcagctaaactgtgt 820  T
Q  211 cccttctgtccacacctgaaacacttcatctc 242  Q
    ||||| || ||||||||||| |||||| ||||    
T  819 cccttttgaccacacctgaagcacttcctctc 788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1032 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold1032
Description:

Target: scaffold1032; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 969 - 799
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||| | ||| ||| |||| || ||||| |||||||||||||| || || || ||||| ||||||||||| || || | | |||||||||||     
T  969 gtttgcgtaccggtcaaagcaaacaccttaccaccagtcctaaccttctttggctgcgtacactgcgaactgatatgtccttcct-cgttgcagttataa 871  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || || |||||||| ||||||||||    ||| |||||||| ||||||||||| |||||| |||||    
T  870 caaacaatgtccccacgcttacaatcagctagtgtgtgtcccttctgaccacacctgaagcacttcttctca 799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0106 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0106
Description:

Target: scaffold0106; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 34487 - 34657
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||||||| |||| || ||||| ||||||||||||||||| || || ||||  ||||| |||||||| || | |||||||||||||     
T  34487 gtttgcgtaccagtcaaggcaaacacctttccacctgtcctaaccttcttcggctgcgtacactacgaactaatatgaccttcct-cattgcagttataa 34585  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || |  || |||||||| |||||| ||||   ||| || ||||  ||||||||||| |||||| |||||    
T  34586 caaacaacgtccccacgcttacaatcaactaatgtgtgtcctttctaaccacacctgaagcacttcttctca 34657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0309 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0309
Description:

Target: scaffold0309; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 242
Target Start/End: Original strand, 12877 - 13046
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    |||||||||||||  || ||| |||| || ||||| |||||||||||||| || || || ||||| |||||||||||||| || | |||| ||||| |||    
T  12877 gtttgcgtaccagttaacgcaaacaccttgccacctgtcctaaccttcttaggctgcgtacactgcgaactgatatgaccttc-ttcattacagttgtag 12975  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctc 242  Q
    || || | ||| |||||||| |||||||||||   ||| || ||||| |||||||| || |||||| ||||    
T  12976 caaacaacatccccacgcttacaatcagctaaagtgtgtcctttctgaccacacctaaagcacttcttctc 13046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold2062 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold2062
Description:

Target: scaffold2062; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 1031 - 856
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactg-----agaactgatatgaccctcatccattgcagt 166  Q
    ||||||||||||| ||| ||| |||| || ||||| |||||||||||||||||||| || |||||      |||||||| ||||| || | | |||||||    
T  1031 gtttgcgtaccagtcaaagcaaacaccttaccaccagtcctaaccttcttcggttgtgtacactgcgaactgaactgatgtgaccttcct-cgttgcagt 933  T
Q  167 tatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||||||| || || ||||||||||| ||||||||||    ||| || ||||| |||||| |||| |||||| |||||    
T  932 tatagcaaacaatgtcaccacgcttacaatcagctagtgtgtgtcctttctgaccacacatgaagcacttcttctca 856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0335 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0335
Description:

Target: scaffold0335; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 75 - 243
Target Start/End: Complemental strand, 4455 - 4288
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| ||| ||| |||| || ||||| |||||||||||||| || || || ||||| ||||| ||||| || || || ||| ||||| |||||     
T  4455 tgcgtaccagtcaaagcaaacaccttgccacctgtcctaaccttcttaggctgcgtacactgcgaactaatatgtccttcctc-attacagttgtagcaa 4357  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || ||||| ||||||||||||||||| ||   ||| || ||||| |||||||| || |||||| |||||    
T  4356 acaatatccccacgcttgcaatcagccaatgtgtgtcctttctgaccacacctaaagcacttcttctca 4288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0476 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0476
Description:

Target: scaffold0476; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 696 - 617
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc 154  Q
    |||||||||| ||| ||| |||||||||||||||| |||| |||||| || ||||||||||| |||||||| || |||||    
T  696 tgcgtaccagtcaacgcaaacactttcccaccggttctaatcttctttggctgagtgcactgtgaactgatgtggccctc 617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0165 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0165
Description:

Target: scaffold0165; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 12110 - 12280
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | || || ||||| |||| ||||||||| || || || ||||| ||||| ||||| || || || ||| ||||| |||    
T  12110 gtttgcgtaccagtcaacgcaaataccttgccacctgtccgaaccttcttaggctgcgtacactgtgaactaatatgtccttcttc-attacagttgtag 12208  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || ||||| |||| |||||||||||| ||   ||| || ||||||||||| |||||||||||| |||||    
T  12209 caaacaatatccccacacttgcaatcagccaatgtgtgtcctttctgtccacatctgaaacacttcttctca 12280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0053 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0053
Description:

Target: scaffold0053; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 203
Target Start/End: Complemental strand, 62926 - 62796
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| ||||||| ||||| |||||||| ||||| || || || ||||| |||||||||||| ||| || |||| ||||| |||    
T  62926 gtttgcgtaccagtcaaagcaaacactttgccacctgtcctaactttcttaggctgcgtacactgcgaactgatatga-ccttattcattacagttgtag 62828  T
Q  172 catactatatcaccacgcttgcaatcagctaa 203  Q
     | || | ||| |||||||| |||||||||||    
T  62827 aaaacaacatccccacgcttacaatcagctaa 62796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0053; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 65449 - 65379
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgat 145  Q
    |||||||||| ||| ||| ||||||| |||||||||||||||||||| || || |||||||| ||||||||    
T  65449 tgcgtaccagtcaatgcatacacttttccaccggtcctaaccttctttggctgggtgcactgtgaactgat 65379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 71 - 130
Target Start/End: Original strand, 151716 - 151775
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagt 130  Q
    |||||||||||||| ||  ||| ||||||| |||||||||||||||||||||||||||||    
T  151716 ggtttgcgtaccagtcagagcaaacactttaccaccggtcctaaccttcttcggttgagt 151775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 243
Target Start/End: Original strand, 153727 - 153812
Alignment:
Q  158 cattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    |||||||||||||||| || || || |||||||| |||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  153727 cattgcagttatagcaaacaatgtctccacgcttacaatcagctaatgtgtgtcctttctgaccacacctgaagcacttcttctca 153812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0074 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0074
Description:

Target: scaffold0074; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 15279 - 15351
Alignment:
Q  129 gtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagcta 202  Q
    |||||||| ||||||||||| ||||| || |||||||||||| || || | |||||||||||||||||||||||    
T  15279 gtgcactgtgaactgatatggccctcttc-attgcagttataacaaacaacatcaccacgcttgcaatcagcta 15351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 132 - 237
Target Start/End: Original strand, 41945 - 42049
Alignment:
Q  132 cactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaa 231  Q
    ||||| |||||||||||||| ||  ||||||||||| || || || || || ||||||||||| ||||||||   |||||||||||| |||||||||||     
T  41945 cactgtgaactgatatgaccttcc-ccattgcagttgtaacagacaatgtccccacgcttgcattcagctaaactgtgacccttctgaccacacctgaag 42043  T
Q  232 cacttc 237  Q
    ||||||    
T  42044 cacttc 42049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1299 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold1299
Description:

Target: scaffold1299; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 1999 - 1920
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctc 154  Q
    ||||||| || ||| ||| |||||||||||||||| |||| |||||| || ||||||||||| |||||||| || |||||    
T  1999 tgcgtactagtcaaagcaaacactttcccaccggttctaatcttctttggctgagtgcactgggaactgatgtggccctc 1920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0751 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0751
Description:

Target: scaffold0751; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 5331 - 5501
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| | || || ||||| | ||||  |||||| || || || ||||| |||||||||||||| || || ||| ||||| |||    
T  5331 gtttgcgtaccagtcaacgcaaaaaccttgccacctgacctagacttcttaggctgcgtacactgcgaactgatatgaccttcttc-attacagttgtag 5429  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| |||||||| |||||||||||   ||| || ||||| ||||||||||| |||||| |||||    
T  5430 caaacaacatccccacgcttacaatcagctaaagtgtgtcctttctgaccacacctgaagcacttcttctca 5501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0104 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0104
Description:

Target: scaffold0104; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 243
Target Start/End: Complemental strand, 43573 - 43403
Alignment:
Q  72 gtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatag 171  Q
    ||||||||||||| ||| ||| |||| || ||||| |||| ||||||||| || |   ||||||| || || ||||||||||| || ||  || ||||||    
T  43573 gtttgcgtaccagtcaaagcaaacaccttgccacctgtccgaaccttcttgggcttcttgcactgcgagctaatatgaccctcttc-atcacaattatag 43475  T
Q  172 catactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || | ||| |||||||| |||||||||||   ||| || |||||||||||||| || |||||| |||||    
T  43474 caaacaacatccccacgcttacaatcagctaaagtgtgtcctttctgtccacacctaaagcacttcttctca 43403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 130 - 233
Target Start/End: Original strand, 36706 - 36808
Alignment:
Q  130 tgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctga 229  Q
    |||| |||||||  ||||||||||| ||| ||||| ||| |||| || ||||||| |||||||||||||||||||   ||||||||||  ||||||| ||    
T  36706 tgcattgagaaccaatatgaccctcttcc-ttgcaattaaagcacacaatatcactacgcttgcaatcagctaacgtatgacccttcttgccacaccgga 36804  T
Q  230 aaca 233  Q
    ||||    
T  36805 aaca 36808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1530 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold1530
Description:

Target: scaffold1530; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 71 - 136
Target Start/End: Original strand, 732 - 797
Alignment:
Q  71 ggtttgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactg 136  Q
    |||||||||||||| ||  ||| ||||||| |||||| ||||||||||||||||||| || |||||    
T  732 ggtttgcgtaccagtcagagcaaacactttaccaccgatcctaaccttcttcggttgtgtacactg 797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0088 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0088
Description:

Target: scaffold0088; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 243
Target Start/End: Original strand, 30123 - 30254
Alignment:
Q  111 ctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagctaacacgtga 210  Q
    |||||||||||||| | ||  ||||| ||||||||||||||||| |||||||||||| || || || || || |||||||| || |||||||    |||     
T  30123 ctaaccttcttcggctcaggacactgcgaactgatatgaccctc-tccattgcagttgtaacagacaatgtccccacgcttacattcagctaggttgtgt 30221  T
Q  211 cccttctgtccacacctgaaacacttcatctca 243  Q
    |  ||||| ||||||||||| |||||| |||||    
T  30222 cttttctgaccacacctgaatcacttcctctca 30254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 243
Target Start/End: Original strand, 251775 - 251939
Alignment:
Q  75 tgcgtaccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcat 174  Q
    |||||||||| | | ||| |||||| ||||||||||||| |   |||||| ||||| ||||| |||||||||||||| || | | |||||||| |||||     
T  251775 tgcgtaccagtccatgcaaacacttccccaccggtcctagc---cttcggctgagtacactgtgaactgatatgaccttc-ttcgttgcagttttagcaa 251870  T
Q  175 actatatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    || || || |||||||| || |||||||    ||| || ||||| |||||||| ||||| ||| |||||    
T  251871 acaatgtctccacgcttacattcagctagtgtgtgtcctttctgaccacacctaaaacatttcctctca 251939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0443 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0443
Description:

Target: scaffold0443; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 12058 - 12111
Alignment:
Q  184 ccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  12058 ccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 12111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0405 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0405
Description:

Target: scaffold0405; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 5863 - 5916
Alignment:
Q  184 ccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    ||||||||||||||||||||   ||| || ||||||||||| ||||||||||||    
T  5863 ccacgcttgcaatcagctaatgtgtgtcctttctgtccacatctgaaacacttc 5916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0276 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0276
Description:

Target: scaffold0276; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 23966 - 23913
Alignment:
Q  184 ccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttc 237  Q
    ||||||||||| ||||||||   |||||||||||| ||||||||||| ||||||    
T  23966 ccacgcttgcattcagctaaactgtgacccttctgaccacacctgaagcacttc 23913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0266 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0266
Description:

Target: scaffold0266; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 243
Target Start/End: Original strand, 16817 - 16957
Alignment:
Q  102 ccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatactatatcaccacgcttgcaatcagct 201  Q
    ||||| |||||||||||||| |  || || ||||| ||||| ||||| || || || ||| ||||| ||||| || ||||| |||||||||||||||||     
T  16817 ccacctgtcctaaccttcttagtctgcgtacactgcgaactaatatgtccttcctc-attacagttgtagcaaacaatatccccacgcttgcaatcagcc 16915  T
Q  202 aacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    ||   ||| || ||||| |||||||| || |||||| |||||    
T  16916 aatgtgtgtcctttctgaccacacctaaagcacttcttctca 16957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 243
Target Start/End: Complemental strand, 67255 - 67092
Alignment:
Q  79 taccagccaaggcacacactttcccaccggtcctaaccttcttcggttgagtgcactgagaactgatatgaccctcatccattgcagttatagcatacta 178  Q
    |||||| ||| ||| ||||||| ||||| || |||||| ||||||| | | | || || ||||| |||||||| || |||||||||||| ||||| || |    
T  67255 taccagtcaatgcaaacacttttccaccagttctaaccctcttcggctcactacattgcgaactaatatgaccttc-tccattgcagttgtagcagacaa 67157  T
Q  179 tatcaccacgcttgcaatcagctaacacgtgacccttctgtccacacctgaaacacttcatctca 243  Q
    | || ||| |||| || |||||||    ||| ||||| || |||||||||||||| ||| |||||    
T  67156 tgtccccaagcttacattcagctaggttgtgtcccttttgaccacacctgaaacatttcctctca 67092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University