View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0678_low_30 (Length: 316)

Name: NF0678_low_30
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0678_low_30
NF0678_low_30
[»] chr3 (1 HSPs)
chr3 (194-242)||(16005826-16005874)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 16005874 - 16005826
Alignment:
Q  194 caaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgc 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  16005874 caaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgc 16005826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University