View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0674_high_24 (Length: 248)

Name: NF0674_high_24
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0674_high_24
NF0674_high_24
[»] scaffold0428 (2 HSPs)
scaffold0428 (1-139)||(2456-2594)
scaffold0428 (23-139)||(15059-15174)
[»] chr6 (8 HSPs)
chr6 (1-139)||(33258335-33258473)
chr6 (1-134)||(33414707-33414840)
chr6 (1-139)||(33293113-33293251)
chr6 (36-128)||(28872999-28873091)
chr6 (1-134)||(33395193-33395326)
chr6 (18-82)||(31564920-31564984)
chr6 (23-139)||(33279079-33279194)
chr6 (12-57)||(33269695-33269740)
[»] chr2 (1 HSPs)
chr2 (1-139)||(17447703-17447842)


Alignment Details
Target: scaffold0428 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0428
Description:

Target: scaffold0428; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 2456 - 2594
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2456 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 2555  T
Q  101 gcacgagctttcttacagtccatcatccctgcacaggtt 139  Q
    |||||||||||||||||||||||||||||||||| ||||    
T  2556 gcacgagctttcttacagtccatcatccctgcaccggtt 2594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0428; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 15174 - 15059
Alignment:
Q  23 ccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtcca 122  Q
    ||||||||||| ||||| ||| |||||||||||||  | || |||||||||| ||||||| ||| |||||| ||||||||| | || || ||||||||||    
T  15174 ccggatttcttgtcagctgataagagaccctttttc-taaggtatgcttgcgccttttcatgataaccttcagtttcggcaagggcattattacagtcca 15076  T
Q  123 tcatccctgcacaggtt 139  Q
    || |||| |||| ||||    
T  15075 tcgtcccagcaccggtt 15059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 33258335 - 33258473
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33258335 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 33258434  T
Q  101 gcacgagctttcttacagtccatcatccctgcacaggtt 139  Q
    |||||||||||||||||||||||||||||||||| ||||    
T  33258435 gcacgagctttcttacagtccatcatccctgcaccggtt 33258473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 33414707 - 33414840
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 100  Q
    |||||||||  |||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||||| ||||| |||||     
T  33414707 tcttccttcagctgctagtcttccggatttcttatcagcggatgagagaccctttttcctgagatatgcttgcgccttttcaagatcgccttccgtttca 33414806  T
Q  101 gcacgagctttcttacagtccatcatccctgcac 134  Q
    ||| ||||||||||||||||||||||||||||||    
T  33414807 gcaagagctttcttacagtccatcatccctgcac 33414840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 33293113 - 33293251
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 100  Q
    |||||||||  |||||||||| | |||||||||||||||| ||||||||||||||||  |||| ||||||| |  ||||||||||||||||||||||||     
T  33293113 tcttccttcagctgctagtcttctggatttcttatcagcgaatgagagacccttttttctgaggtatgctttcaccttttcaagatcaccttctgtttca 33293212  T
Q  101 gcacgagctttcttacagtccatcatccctgcacaggtt 139  Q
    ||| ||||||||||||||||||||||||| |||| ||||    
T  33293213 gcatgagctttcttacagtccatcatcccagcaccggtt 33293251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 36 - 128
Target Start/End: Complemental strand, 28873091 - 28872999
Alignment:
Q  36 cagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtccatcatcc 128  Q
    |||| ||||||||||||||||   |||| ||||||| || |||||||||||||||||||||||||||| | ||||||||||||||||||||||    
T  28873091 cagcagatgagagacccttttatctgaggtatgcttacgccttttcaagatcaccttctgtttcggcaagggctttcttacagtccatcatcc 28872999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 33395193 - 33395326
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg 100  Q
    |||||||||  ||||||| || ||||||||||| ||||| ||||||||||||||| |  | || |||| ||| | |||||||||||||||||  ||||||    
T  33395193 tcttccttcagctgctagcctaccggatttcttgtcagctgatgagagaccctttgttctaaggtatgattgggccttttcaagatcacctttagtttcg 33395292  T
Q  101 gcacgagctttcttacagtccatcatccctgcac 134  Q
    ||    ||||||||||||||||| ||||| ||||    
T  33395293 gctaaggctttcttacagtccataatcccagcac 33395326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 31564984 - 31564920
Alignment:
Q  18 gtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttca 82  Q
    |||| ||||||||||| |||||||||||||||||||||||  |||| |||||||||| |||||||    
T  31564984 gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca 31564920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 139
Target Start/End: Original strand, 33279079 - 33279194
Alignment:
Q  23 ccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtcca 122  Q
    ||||||||||| ||||| ||| |||||||||||||  | || |||||||||| ||||||| ||| |||||| ||||||||| | || || ||||||||||    
T  33279079 ccggatttcttgtcagctgataagagaccctttttc-taaggtatgcttgcgccttttcatgataaccttcagtttcggcaagggcattattacagtcca 33279177  T
Q  123 tcatccctgcacaggtt 139  Q
    || |||| |||| ||||    
T  33279178 tcgtcccagcaccggtt 33279194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 33269695 - 33269740
Alignment:
Q  12 ctgctagtctcccggatttcttatcagcggatgagagacccttttt 57  Q
    ||||||||||  | || |||||||||||||||||||||||||||||    
T  33269695 ctgctagtcttgcagacttcttatcagcggatgagagacccttttt 33269740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 17447842 - 17447703
Alignment:
Q  1 tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccc-tttttgatgagatatgcttgcggcttttcaagatcaccttctgtttc 99  Q
    |||||||||  |||| ||||| |||||||||||||||||||||||||||||| |||||  |||| |||||||||| |||||||||||||||||| |||||    
T  17447842 tcttccttcagctgccagtcttccggatttcttatcagcggatgagagaccccttttttctgaggtatgcttgcgccttttcaagatcaccttcagtttc 17447743  T
Q  100 ggcacgagctttcttacagtccatcatccctgcacaggtt 139  Q
    |||| | ||||||||||||||||| ||||| |||| ||||    
T  17447742 ggcaagggctttcttacagtccataatcccagcaccggtt 17447703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University