View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_87 (Length: 264)

Name: NF0673_low_87
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_87
NF0673_low_87
[»] chr8 (1 HSPs)
chr8 (125-165)||(25839997-25840037)


Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 125 - 165
Target Start/End: Original strand, 25839997 - 25840037
Alignment:
Q  125 actattagacactgagttgcttcttcgtgtggttcatctta 165  Q
    |||||||||||||||||||||||||||||||||||| ||||    
T  25839997 actattagacactgagttgcttcttcgtgtggttcacctta 25840037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University