View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_17 (Length: 430)

Name: NF0673_low_17
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_17
NF0673_low_17
[»] chr6 (1 HSPs)
chr6 (258-330)||(24284425-24284495)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 258 - 330
Target Start/End: Original strand, 24284425 - 24284495
Alignment:
Q  258 taaatcatcaataagccttcaaacatcgtcaaaaaccacacatgcgcgcacacacactaacccataaaatgag 330  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
T  24284425 taaatcatcaataagccttcaaacatcgtcaaaaaccacacat--gcgcacacacactaacccataaaatgag 24284495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University