View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0672_low_31 (Length: 204)

Name: NF0672_low_31
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0672_low_31
NF0672_low_31
[»] chr8 (1 HSPs)
chr8 (1-127)||(5297236-5297361)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 5297236 - 5297361
Alignment:
Q  1 agtatttggcattgtcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatat 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5297236 agtatttggcatt-tcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatat 5297334  T
Q  101 aatttgacttttggacatattcttcga 127  Q
    |||||||||||||||||||| ||||||    
T  5297335 aatttgacttttggacatatgcttcga 5297361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University