View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0621_high_16 (Length: 220)

Name: NF0621_high_16
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0621_high_16
NF0621_high_16
[»] chr8 (1 HSPs)
chr8 (1-121)||(31455437-31455557)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 31455437 - 31455557
Alignment:
Q  1 ttctcttttactattcatatcaacgccaagacttcgaacaacaaaaggatcatcgttgatctcgaagcttaatccaacaagattgttttcttcagagaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31455437 ttctcttttactattcatatcaacgccaagacttcgaacaacaaaaggatcatcgttgatctcgaagcttaatccaacaagattgttttcttcagagaat 31455536  T
Q  101 gaacataagaacacagatttt 121  Q
    |||||||||||||||||||||    
T  31455537 gaacataagaacacagatttt 31455557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University