View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0619_low_53 (Length: 251)

Name: NF0619_low_53
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0619_low_53
NF0619_low_53
[»] scaffold0291 (1 HSPs)
scaffold0291 (13-251)||(13019-13252)


Alignment Details
Target: scaffold0291 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 13019 - 13252
Alignment:
Q  13 tgaagcaaacaagctcgatatcacaccaccaagaacatggatctacatcttgacacccggatttggatttttgggtggtaaagggcagaggtggtggtgg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||    
T  13019 tgaagcaaacaagctcgatatcacaccaccaagaacatggatctacatcttgacaactggatttggatttttgggtggtaaagggcggaggtggtggtgg 13118  T
Q  113 tgatgggttcggaaagcttccttagtgagaatggagagaaacgtaagttcaaaaatgagggaatctcgatgtttttgaatttctaattataacaaacctt 212  Q
       |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||     
T  13119 ---tgggttgggaaagcttccttagttagaatggagagaaacgtaagttcaaaaatgagggaa--tcgatgtttttgaatttctaattataacaaacctg 13213  T
Q  213 tcaaatcatacctaacacaccatgtttaactttttcaat 251  Q
    | ||||||||||||||| |||||||||||||||||||||    
T  13214 ttaaatcatacctaacaaaccatgtttaactttttcaat 13252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University