View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0619_low_18 (Length: 393)

Name: NF0619_low_18
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0619_low_18
NF0619_low_18
[»] chr3 (1 HSPs)
chr3 (86-240)||(48193773-48193927)


Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 48193927 - 48193773
Alignment:
Q  86 cctagctgttgccgacatgaatgcttcgctattctcgaaatcacaggtagatacaaataaataactacaggctgcgctcacttcannnnnnnnnnnnngg 185  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             ||    
T  48193927 cctagcagttgccgacatgaatgcttcgctattctcgaaatcacaggtagatacaaataaataactacaggctgcgctcacttcatttttatttttttgg 48193828  T
Q  186 tgaattggctggccacttcattttgaattgaatccaaaagtataccataaaaagt 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48193827 tgaattggctggccacttcattttgaattgaatccaaaagtataccataaaaagt 48193773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University