View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0609_low_10 (Length: 211)

Name: NF0609_low_10
Description: NF0609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0609_low_10
NF0609_low_10
[»] chr3 (1 HSPs)
chr3 (1-71)||(32822463-32822533)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 32822463 - 32822533
Alignment:
Q  1 cgtttccgtctgctatgcagcggggatgnnnnnnngagagatttgttgcttttgctttgattgagtctctg 71  Q
    ||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
T  32822463 cgtttccgtctgctatgcagcggggatgtttttttgagagatttgttgcttttgctttgattgagtctctg 32822533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University