View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0605_low_22 (Length: 201)

Name: NF0605_low_22
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0605_low_22
NF0605_low_22
[»] chr4 (1 HSPs)
chr4 (1-124)||(53866111-53866234)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 53866111 - 53866234
Alignment:
Q  1 caacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgtca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53866111 caacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgtca 53866210  T
Q  101 attgtcctttgggtccgttatatt 124  Q
    ||||||||||||||||||||||||    
T  53866211 attgtcctttgggtccgttatatt 53866234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University