View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0605_low_20 (Length: 250)

Name: NF0605_low_20
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0605_low_20
NF0605_low_20
[»] chr8 (3 HSPs)
chr8 (14-137)||(42357333-42357456)
chr8 (210-248)||(42357824-42357862)
chr8 (143-172)||(42357785-42357814)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 137
Target Start/End: Original strand, 42357333 - 42357456
Alignment:
Q  14 atatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaataactttgcgtttagttatagtttcaacca 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  42357333 atatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaacaactttgcgtttagttatagtttcaacca 42357432  T
Q  114 ttattatctatcgtactagacaaa 137  Q
    |||| |||||||||||||||||||    
T  42357433 ttatcatctatcgtactagacaaa 42357456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 210 - 248
Target Start/End: Original strand, 42357824 - 42357862
Alignment:
Q  210 tattttatcactggtattggtatatcattttttgaatta 248  Q
    ||||||||||||||||||||||||||||||| |||||||    
T  42357824 tattttatcactggtattggtatatcattttatgaatta 42357862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 172
Target Start/End: Original strand, 42357785 - 42357814
Alignment:
Q  143 attaactgattatatactccttttaataaa 172  Q
    ||||||||||||||||||||||||||||||    
T  42357785 attaactgattatatactccttttaataaa 42357814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University