View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0605_low_10 (Length: 322)

Name: NF0605_low_10
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0605_low_10
NF0605_low_10
[»] chr3 (1 HSPs)
chr3 (96-217)||(50510893-50511014)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 96 - 217
Target Start/End: Original strand, 50510893 - 50511014
Alignment:
Q  96 acgaataacctcaccaagaagaggacaccatgatttacttgcaaaccaagaaatcaagcaaccgaataaaatacatacttgcacacctatccataacatc 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50510893 acgaataacctcaccaagaagaggacaccatgatttacttgcaaaccaagaaatcaagcaaccgaataaaatacatacttgcacacctatccataacatc 50510992  T
Q  196 aattttttgttaagatattttt 217  Q
    ||||||||||||||||||||||    
T  50510993 aattttttgttaagatattttt 50511014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University