View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0603_low_14 (Length: 370)

Name: NF0603_low_14
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0603_low_14
NF0603_low_14
[»] chr8 (2 HSPs)
chr8 (100-256)||(40749570-40749726)
chr8 (1-55)||(40749771-40749825)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 100 - 256
Target Start/End: Complemental strand, 40749726 - 40749570
Alignment:
Q  100 agaaacaaacaaaaaacaatcatttgaataaaattaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag 199  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40749726 agaaacaaacaaaaaacaatcatttgaataaaataaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag 40749627  T
Q  200 cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct 256  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40749626 cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct 40749570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40749825 - 40749771
Alignment:
Q  1 gtgtgcgtcaccatcatcataaatattcattcatatcatataatcaaacagtaac 55  Q
    ||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
T  40749825 gtgtgcgtcaccatcatcataaatattcattcatatcataacatcaaacagtaac 40749771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University