View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0602_low_36 (Length: 275)

Name: NF0602_low_36
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0602_low_36
NF0602_low_36
[»] chr8 (1 HSPs)
chr8 (12-246)||(32805981-32806215)
[»] chr6 (1 HSPs)
chr6 (41-246)||(6094731-6094936)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 32806215 - 32805981
Alignment:
Q  12 aagaattaaaggtgcaatatcaactaatagagaggcaccatgaaggcaattaactacagattttgcatcaagttcaacaataacattacacaattgcttt 111  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  32806215 aagaattaaaggtgcaatatcaactaacagagaggcaccatgaaggcaattaactacagattctgcatcaagttcaacaataacattacacaattgcttt 32806116  T
Q  112 tccatagccctagcgagacaccaccgcaaacccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcaaacaaaaccagac 211  Q
    |||||  ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  32806115 tccatgaccctagctaggcaccaccgcaaacccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcacacaaaaccagac 32806016  T
Q  212 ctgcagcgttgcgcacaaccatcccccaacctgtc 246  Q
    |||||||||||||||||||||||||||||||||||    
T  32806015 ctgcagcgttgcgcacaaccatcccccaacctgtc 32805981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 41 - 246
Target Start/End: Original strand, 6094731 - 6094936
Alignment:
Q  41 gagaggcaccatgaaggcaattaactacagattttgcatcaagttcaacaataacattacacaattgcttttccatagccctagcgagacaccaccgcaa 140  Q
    ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  6094731 gagaggcaccatgaaggcaattaaccacagattctgcatcaagttcaacaataacattacacaattgcttttccatggccctagcgagacaccaccgcaa 6094830  T
Q  141 acccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaa 240  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6094831 acccatgcattcagctaccaaaggtgacaccgagataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaa 6094930  T
Q  241 cctgtc 246  Q
    ||||||    
T  6094931 cctgtc 6094936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University